Journal of Animal Science and Technology
Korean Society of Animal Sciences and Technology
RESEARCH ARTICLE

Antimicrobial activity of Pediococcus pentosaceus strains against diarrheal pathogens isolated from pigs and effect on paracellular permeability of HT-29 cells

Eunbee Cho1,#https://orcid.org/0000-0002-1164-3162, Yoonjeong Yoo1,#https://orcid.org/0000-0003-4575-3682, Yohan Yoon1,*https://orcid.org/0000-0002-4561-6218
1Department of Food and Nutrition, Sookmyung Women’s University, Seoul 04310, Korea
*Corresponding author: Yohan Yoon, Department of Food and Nutrition, Sookmyung Women’s University, Seoul 04310, Korea, Tel: +82-2-2077-7585, E-mail: yyoon@sookmyung.ac.kr

# These authors contributed equally to this work.

© Copyright 2025 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Jan 19, 2024; Revised: Mar 27, 2024; Accepted: Apr 22, 2024

Published Online: Jul 31, 2025

Abstract

This study aimed to investigate lactic acid bacteria with antimicrobial activities against infectious diarrheal pathogens in pigs and their genetic characteristics. Acid-resistant lactic acid bacteria were examined for bile resistance, pancreatic enzyme resistance, gelatinase and urease activities, and antibiotic resistance. Subsequently, selected isolates were examined for antimicrobial activities against Campylobacter coli, Clostridium perfringens, Escherichia coli, and Salmonella Typhimurium, and their effects on paracellular permeability and the expression of tight junction protein-encoding genes in HT-29 cells were assessed. Whole genome sequencing was performed to identify the genes related to safety and antibacterial activity. Of the 51 isolates examined, 12 were resistant to bile and pancreatin and did not produce gelatinase and urease. Of these 12, isolates 19, 20, 30, 36, and 67 showed tetracycline resistance and isolates 15, 19, and 38W showed antimicrobial activity against infectious diarrheal bacteria. Treatment with isolate 38W significantly reduced the paracellular permeability induced by E. coli in HT-29 cells and alleviated the expression of tight junction protein-encoding genes (claudin-1, occludin, and ZO-1) induced by E. coli inoculation. Isolates 15, 19, and 38W were named as Pediococcus pentosaceus SMFM2016-NK1, SMFM2016-YK1, and SMFM2016-WK1, respectively. Bacteriocin-related genes were YheH, ytrF, BceA, BceB, and MccF in SMFM2016-NK1; YheH, ytrF, BceA, BceB, entK, lcnA, MccF, and skgD in SMFM2016-YK1; and YheH, ytrF, BceA, BceB, and MccF in SMFM2016-WK1. SMFM2016-YK1 harbored the tetM gene. These results indicate that P. pentosaceus SMFM2016-WK1 might control diarrheal pathogens isolated from pigs. However, a further study is necessary because the results were obtained only from in vitro experiment.

Keywords: Antimicrobial agent; Feed additive; Probiotics; Gut health; Lactic acid bacteria

INTRODUCTION

Diarrhea frequently occurs in weaning pigs and is thus a notable issue at pig farms [1]. The major pathogens in weaning pigs are Campylobacter spp., Clostridium perfringens, Escherichia coli, Salmonella spp., group A rotaviruses, and coronaviruses [1]. Pathogenic bacteria cause intestinal infections, leading to swine morbidity and mortality, especially in weaning pigs, resulting in economic losses [2].

Antibiotics have been used in livestock feed for decades to promote health and growth [3]. However, many countries have restricted the use of antibiotics owing to antibiotic resistance. Thus, the development of alternatives to antibiotics, including probiotics, acidification agents, and functional natural extracts, has become a major research area. Among these alternatives, probiotics are mainly used, because they can improve intestinal microbial balance and hence play a beneficial role in the host animal [4,5].

Probiotics are living microorganisms that provide health benefits to the host when administered appropriately [6–8]. Probiotics can enhance host health by producing short-chain fatty acids and regulating the immune system [9]. Moreover, some probiotic bacterial strains can be used as antimicrobial agents in various internal organs such as the intestine, periodontal tract, female urogenital tract, and immune organs [10]. Recently, probiotics have been introduced to feeds to protect weaning pigs from diseases and thus, increase their growth rates [11–13]. Bacteria such as Lactobacillus, Pediococcus, Streptococcus, Enterococcus, Bifidobacterium, and lactic acid bacteria have beneficial functional properties and are widely used as probiotics in weaning pigs [14–16]. A previous study showed that lactic acid bacteria isolated from kimchi exhibited antioxidant and anti-inflammatory effects [17]. Hence, it is worth investigating whether these isolates have antimicrobial activity against pathogenic bacteria and strengthen the gut barrier. Even though selected isolates show the antimicrobial activity, they should survive in the intestinal stress environment with no harmful effects in the host. Thus, the resistance of isolates to acid, bile and pancreatic enzyme, and their activities of hemolysis, gelatinase, and urease need to be examined [18–20]. Therefore, this study investigated lactic acid bacteria to control diarrheal pathogens isolated from pigs.

MATERIALS AND METHODS

Preparation of lactic acid bacteria inocula

One hundred microliters of lactic acid bacteria samples, stored at −80°C, were inoculated into 10 mL Lactobacilli de Man, Rogosa and Sharpe (MRS) broth (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) and cultured aerobically at 37°C for 24 h. Following this, 100 μL culture medium was transferred to fresh 10 mL Lactobacilli MRS broth and incubated at 37°C for 24 h. The cultures were then centrifuged at 1,912×g and 4°C for 15 min. The cell pellets were washed twice with phosphate-buffered solution ([PBS], pH 7.4, 0.2 g KCl, 0.2 g, KH2PO4, 8.0 g NaCl, and 1.5 g Na2HPO4·7H2O in 1 L distilled water), resuspended in 10 mL PBS, and diluted to 7 Log CFU/mL.

Analysis of bile and pancreatic enzyme resistance

A modified version of the method described by Jang [17] and Casey et al. [21] was used for bile resistance analysis. One hundred microliters of each inoculum were inoculated into 10 mL Lactobacilli MRS broth, containing 0.3% porcine bile extract (Sigma, St. Louis, MO, USA), and incubated at 37°C for 24 h. Following inoculation and incubation, 1 mL aliquots were serially diluted in 9 mL of 0.1% buffered peptone water ([BPW], Becton, Dickinson, and Company). The diluents (100 µL) were spread-plated on tryptic soy agar ([TSA], Becton, Dickinson, and Company). The plates were incubated at 37°C for 48 h, after which the colonies were counted manually. Pancreatic enzyme resistance was analyzed according to the method described by Plessas et al. [22]. One hundred microliters of each inoculum were inoculated into 10 mL PBS (pH 8.0), containing 0.1% pancreatin from porcine pancreas (Sigma), and incubated at 37°C for 4 h. After inoculation and incubation, 1 mL aliquots were serially diluted in 9 mL of 0.1% BPW. The diluents (100 µL) were spread-plated on TSA. The plates were incubated at 37°C for 48 h, after which the colonies were counted manually. The bile and pancreatic enzyme resistance of the isolates was calculated using the following equations:

Bile resistance = ( Colony counts after 24 h of culture/colony counts at 0 h ) × 100 Pancreatic enzyme resistance = ( Colony counts after 4 h of culture/colony counts at 0 h ) × 100.

Lacticaseibacillus rhamnosus GG (LGG; ATCC53103), which was known to be effective against diarrhea [10], was used as the positive control (PC). The results of bile and pancreatic enzyme resistance of the isolates were compared with those of LGG [23].

Evaluation of safety
Analysis of gelatinase and urease production

Gelatinase activity was measured according to the manufacturer’s instructions (MB cell, Seoul, Korea). An isolated colony of each strain on Lactobacilli MRS agar (Becton, Dickinson, and Company) was inoculated into 2 mL nutrient gelatin (MB cell). The inoculated medium was incubated at 37°C for 4 days and then stored at 4°C for 30 min. Coagulation of the medium indicated gelatinase activity. Staphylococcus aureus ATCC25922 inoculated into 2 mL nutrient gelatin was used as the PC, while nutrient gelatin was used as the negative control. Urease activity was examined by modifying the method described by Brink [24]. Three microliters of each inoculum were inoculated onto urea agar (pH 6.5), which comprised 20 g yeast extract, 10 g ammonium chloride, 3 g sodium chloride, 20 g urea, 0.012 g phenol red, and 15 g agar dissolved in 1 L distilled water, and incubated at 37°C for 48 h. Vibrio vulnificus NCCP11887 and Escherichia coli NCCP14038 were used as PCs.

Evaluation of antibiotic resistance

To determine the resistance of each isolate to antibiotics, eight antibiotics (ampicillin, gentamicin, kanamycin, streptomycin, erythromycin, clindamycin, tetracycline, and chloramphenicol) suggested by the European Food Safety Authority [25] were used. The minimum inhibitory concentrations (MICs) of the isolates to each antibiotic were elucidated using antibiotic coated Sensititre™ CAMPY2, and CMV3AGNF MIC plates according to the manufacturer’s instructions (Thermo Fisher Scientific, Waltham, MA, USA). The MICs were determined based on the microbiological cut-off reference values suggested by the EFSA [25].

Analysis of antimicrobial effect of isolates against diarrheal pathogens
Preparation of isolate inoculum

One hundred microliters of each strain in 20% glycerol stock were added to 10 mL Lactobacilli MRS broth and incubated at 37°C for 24 h. After that, 100 μL aliquots of culture medium were transferred to 10 mL of a fresh Lactobacilli MRS broth and incubated at 37°C for 24 h. The cultures were then transferred to a 15 mL conical tube and centrifuged at 1,912×g and 4°C for 15 min. The cell pellets were washed twice with PBS, resuspended in 10 mL PBS, and diluted to 9 Log CFU/mL. For PC, 1-g amounts of three commercial probiotics (PC1, PC2, and PC3) were suspended in 9 mL distilled water. The commercial probiotic suspensions were then filtered using a filter bag (3M, St. Paul, MN, USA), and the filtrates were diluted with PBS to achieve an OD600 = 1.0. Each lactic acid bacterial suspension and the commercial probiotic diluents (3 μL) were spot-inoculated onto Lactobacilli MRS agar, and the plates were incubated at 37°C for 24 h. Cultured agar plates were then used to overlay the pathogenic bacteria.

Preparation of diarrheal pathogens

Diarrheal pathogens isolated from pigs were obtained from the Korea Veterinary Culture Collection ([KVCC], Gimcheon, Korea). A bead stock of each Campylobactercoli strain (KVCC-BA1800493, BA1800494, and BA1800595) in 20% glycerol was streaked onto Columbia blood agar (BioMerieux, Marcy-l’Etoile, Lyon, France) and incubated at 42°C for 48 h under microaerobic conditions (5% O2, 10% CO2, and 85% N2) using a microaerobic gas pack (Oxoid, Basingstoke, UK). Colonies on the Columbia agar were collected using a loop (SPL Life Sciences, Pocheon, Korea) and restreaked onto fresh Columbia blood agar. The plates were incubated at 42°C for 48 h under microaerobic conditions [26]. One hundred microliters of each Clostridium perfringens strain (KVCC- BA1900009, BA1900010, BA1900011, and BA1700250) in 20% glycerol stock were inoculated in 10 mL cooked meat broth and cultured at 37°C for 24 h in an anaerobic chamber (Coy Laboratory Products, Grass Lake, MI, USA) containing 90% N2, 5% CO2, and 5% H2. Next, 1 mL of the culture was transferred to 10 mL brain heart infusion (BHI) broth (Beckton Dickinson and Company) and incubated at 37°C for 24 h under anaerobic conditions using an anaerobic gas pack (Oxoid). One hundred microliters of each E. coli (KVCC-BA0001423, BA0001823, and BA1600302) and Salmonella Typhimurium (KVCC-BA2000160 and BA2000161) strain in 20% glycerol stock were cultured in 10 mL tryptic soy broth ([TSB], Beckton Dickinson and Company) at 37°C for 24 h. Then, 100 µL of the culture was transferred to fresh 10 mL TSB and incubated at 37°C for 24 h. Subcultures of the pathogens were harvested using the procedure described in the ‘Preparation of lactic acid bacteria inocula’ section.

Agar diffusion assay

Aliquots (100 µL) of E. coli, S. Typhimurium, and C. perfringens inocula were inoculated into soft BHI agar (10 mL), and the inoculated BHI agar was overlaid onto the prepared Lactobacilli MRS agar. The plates were then incubated aerobically (E. coli and S. Typhimurium) or anaerobically (C. perfringens) at 37°C for 24 h. Aliquots (100 µL) of C. coli inoculum were inoculated into 10 mL soft modified charcoal cefoperazone deoxycholate agar ([mCCDA], Oxoid), and the inoculated mCCDA agar was then overlaid onto the prepared Lactobacilli MRS agar. The plates were incubated microaerobically at 42°C for 48 h. The size of the growth inhibition zone (mm) was measured using a caliper. The growth inhibition zones of the isolates were compared to those of the PC [27].

Analysis of effects of lactic acid bacteria on infectious diarrhea
Cell line and culture conditions

To evaluate the effects of the isolates on colonic cells, HT-29 cells, human colorectal cancer cells, were obtained from the Korean Cell Line Bank (Seoul, Korea). The cells were cultured in Dulbecco’s modified Eagle’s medium ([DMEM], Hyclone, Logan, UT, USA), supplemented with 10% Fetal Bovine Serum ([FBS], Gibco, Waltham, MA, USA) and 1% penicillin-streptomycin solution ([PS], Gibco), in a 75T flask (Corning, Corning, NY, USA) at 37°C under 5% CO2 for 24 h. The cultured cells were then transferred to a fresh medium, incubated for another 24 h, and washed with Dulbecco’s phosphate-buffered saline ([DPBS], Welgene, Gyeongsan, Korea). The cultured cells were then detached using 3 mL of 0.05% trypsin-0.02% EDTA (Gibco) and centrifuged at 217×g and 25°C for 5 min. The cell pellets were resuspended in 10 mL fresh DMEM supplemented with 10% FBS and 1% PS.

Analysis of paracellular permeability

To examine the effect of the isolated lactic acid bacteria(15, 19, and 38W) on the paracellular permeability of HT-29, 500 µL HT-29 cells were seeded into the upper chamber of a 12-transwell plate (0.4 μm pore size; Corning), at a density of 2.5×105 cells/well, and cultured to form a monolayer at 37°C under 5% CO2 for 24 h. The cells were then subjected to no treatment (non-treated) and treatment with E. coli NCCP11142 (EC), PC (LGG), isolate 15 (LAB15), isolate 19 (LAB19), isolate 38W (LAB38W), PC+EC, LAB15+EC, LAB19+EC, and LAB38W+EC. The inocula of the three selected isolates (15, 19, and 38W) and LGG were prepared using the procedure described in the ‘Preparation of lactic acid bacteria inocula’ section. The isolate inocula were diluted with DMEM, containing 10% FBS, to 1×108 CFU/mL, and 100 μL of the diluents were inoculated on the upper layer of the transwell plate. Four hundred microliters of DMEM containing 10% FBS without isolates were added to the lower chamber of the transwell and incubated at 37°C under 5% CO2 for 6 h. After incubation, the cells in the upper layer of the transwell plate were washed three times with DPBS. One hundred microliters of DMEM containing 10% FBS and E. coli (1×106 CFU/mL) were added to the upper layer of the transwell plate, and the plate was then placed at 37°C under 5% CO2 for 3 h. As LGG promoted the expression of cytoprotective genes to reduce intestinal permeability and enhance intestinal defense, it was used as the PC [28,29]. After incubation, each upper layer of the transwell was washed three times with DPBS. One hundred microliters of DMEM supplemented with 10% FBS and 1 mg/mL FD-4 (4 kDa molecular weight; Sigma) were added in the upper chamber of the transwell. Four hundred microliters of cell-free DMEM plus 10% FBS were added in the lower layer of the transwell and incubated at 37°C under 5% CO2 for 3 h. After incubation, the fluorescence of the medium in the lower layer of the transwell was measured to evaluate the paracellular permeability caused by bacterial treatment; this was done according to the method described by Wang et al. [30], with some modifications. One hundred microliters of the medium in the lower chamber of the transwell plate were collected, and FD-4 concentration was quantified using SpectraMax i3 (Molecular Devices, Chicago, IL, USA) at excitation and emission wavelengths of 485 and 535 nm, respectively. The paracellular permeability caused by bacterial treatment was calculated using the following equation and was shown in “% of control” [47].

Paracellular permeability  ( % ) = Fluorescence of treated sample Fluorescence of control × 100
Analysis of expression of tight junction (TJ) protein-encoding genes

Five hundred microliters of HT-29 cells were seeded into 6-well plates (SPL Life Sciences), at a density of 2.5×105 cells/well, and cultured at 37°C with 5% CO2 for 24 h. Three selected isolates (15, 19, and 38W) were cultured using the same procedure described in the ‘Preparation of lactic acid bacteria inocula’ section. The isolate suspensions were diluted with DMEM, containing 10% FBS, to 1×108 CFU/mL. HT-29 cells were pre-treated with the isolate diluent (150 µL) and then cultured at 37°C under 5% CO2 for 6 h. The supernatant was discarded, and the cells were washed with DPBS. The cells were then treated with DMEM containing 10% FBS and 1×106 CFU/mL E. coli NCCP11142 and cultured at 37°C under 5% CO2 for 3 h. After treatment, the supernatant was discarded, and the cells were washed with DPBS. The HT-29 cells were collected and lysed with TRIzol (Invitrogen, Carlsbad, CA, USA) to extract mRNA according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The expression of TJ-encoding genes (claudin-1, occludin, and ZO-1) was determined via quantitative reverse transcription (qRT)-PCR using the Rotor-Gene SYBR Green PCR kit and Rotor-Gene Q (Qiagen). The 25 µL reaction mixture contained 1 µL template cDNA, 12.5 µL 2×rotor-gene SYBR® green PCR master mix, 6.5 µL RNase-free water, 2.5 µL forward primer, and 2.5 µL reverse primer. The PCR conditions were as follows: 95°C for 10 min, followed by 40 amplification cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 20 s; the primers used in this study are listed in Table 1. Relative transcription levels were normalized to those of β-actin. Relative gene expression was calculated using the 2−△△Ct method [31].

Table 1. Primer sequences used to determine the expression of genes encoding tight junction proteins using quantitative reverse transcription-PCR
Target gene Primer sequence (5′→3′) Reference
claudin-1 Forward AAGTGCTTGGAAGACGATGA [63]
Reverse CTTGGTGTTGGGTAAGAGGTT
occludin Forward CCAATGTCGAGGAGTGGG
Reverse CGCTGCTGTAACGAGGCT
ZO-1 Forward ATCCCTCAAGGAGCCATTC
Reverse CACTTGTTTTGCCAGGTTTTA
β-actin Forward TTTTAGGATGGCAAGGGACTT
Reverse GATGAGTTGGCATGGCTTTA

PCR, polymerase chain reaction.

Download Excel Table
Whole genome analysis
DNA library preparation and sequencing

Whole-genome de novo sequencing was performed to analyze the genomic characteristics of the selected isolates 15, 19, and 38W. The DNA of each isolate was extracted with the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer’s instructions. Briefly, 5 μg of each DNA sample was used to construct a library. The library was constructed with SMRTbell™ Template Prep Kit 1.0 (PN 100-259-100) according to the manufacturer’s instructions (PacBio, MenloPark, CA, USA). The prepared libraries were sequenced with the PacBio RS II platform (PacBio), which produced continuous long reads. The library construction and sequencing were performed by JSLINK (Seoul, Korea). The 20 kb libraries consisting of DNA fragments were then assembled into longer sequences called “contigs”. The genomic characteristics of the contigs were analyzed.

Gene annotation and prediction

The contigs were used for gene annotation and prediction by JSLINK. The Glimmer ver. 3.02 [32] system was used to identify putative gene coding sequences (CDSs) from the contigs and open reading frames (ORFs). Functional gene ontology was predicted and annotated with BLAST2GO (BioBam BioInformatics SL, Valencia, Spain), and the genes were classified into biological processes, cell components, and molecular functions.

Genomic comparison

Gene sequence and phylogenetic analysis of the selected isolates 15, 19, and 38W were performed with CLC Genomics Workbench ver. 12.0 (Qiagen) and the NCBI database. Whole-genome alignment was used to construct a phylogenetic tree, and an Average Nucleotide Identity (ANI) analysis was performed to confirm the degree of agreement with each genetic sequence.

Analysis of antibiotic resistance and bacteriocin-related genes

The genetic characteristics of the selected isolates (15, 19, and 38W) were analyzed for antibiotic resistance factors with the CLC Genomics Workbench ver. 12.0 (Qiagen). The sequences of these factors were obtained from the NCBI GenBank database. The presence of any genetic factors related to antibiotic resistance and bacteriocins in the isolates was determined with the Basic Local Alignment Search Tool (BLAST). Antibiotic resistance was assessed by comparing the sequences of all genes.

Statistical analysis

Data on bile and pancreatic enzyme resistance, antimicrobial activities, and paracellular permeability were analyzed with PROC MIXED procedure of SAS® version OnDemand for Academics (SAS Institute, Cary, NC, USA). The random effect of replication on treatment group (isolate) was tested, and significant differences in Least Squares (LS) means among the treatment groups were determined with Tukey at α = 0.05. Data on gene expression level of TJ proteins were analyzed with PROC GLM procedure of SAS® version OnDemand for Academics (SAS Institute). Significant differences in LS means among the treatment groups were determined with Tukey at α = 0.05.

RESULTS AND DISCUSSION

Probiotic characteristics of the isolates
Bile and pancreatic enzyme resistance

For probiotics to function in the intestines, the isolates must resist any digestive enzymes secreted into the duodenum through the stomach at low pH [18]. In this study, 51 acid-resistant isolates identified by Jang [17] were evaluated for bile and pancreatic enzyme resistance (Table 2). Of the 51 isolates, 45.5%–137.1% and 77.5%–104.0% showed resistance against bile and pancreatic enzymes, respectively. Furthermore, 12 bile- and pancreatic enzyme-resistant isolates (2, 9, 11, 15, 19, 20, 30, 36, 38W, 66, 67, and 70) showed significantly higher (p < 0.05) efficacy than or similar efficacy as that of the PC (Table 3). Pancreatic enzyme resistance of isolate 50 was the lowest among the significant isolates. Thus, it was excluded for a further analysis. These findings indicate that the isolates 2, 9, 11, 15, 19, 20, 30, 36, 38W, 66, 67, and 70 might survive under conditions similar to those found in the pig intestine.

Table 2. Lactic acid bacteria isolates used in this study
Species Strains
Limosilactobacillus fermentum 1, 3, 6, 7, 12, 22, 28, 29, 31, 32, 38Y, 44, 45, 57, 58, 59, 72, 73, 75
Levilactobacillus brevis 4W, 74
Lactiplantibacillus plantarum 8, 10, 13, 49Y, 50, 52, 53, 71, 76, 77
Lactilactobacillus sakei 14, 21, 27, 33, 34, 56, 60
Lactilactobacillus curvatus 35
Pediococcus pentosaceus 2, 9, 11, 15, 19, 20, 30, 36, 38W, 66, 67, 70
Download Excel Table
Table 3. Bile and pancreatic enzyme resistance of lactic acid bacteria isolates
Isolate Tolerance (%)
Bile resistance Pancreatic enzyme resistance
PC* 101.1 ± 6.2JKL 103.3 ± 1.2ab
1 88.6 ± 4.3MN 86.5 ± 2.3lmnopqrst
2 111.9 ± 6.3GHI 99.6 ± 0.9abcdefgh
3 82.2 ± 3.6NOPQ 100.2 ± 1.8abcdefg
4W 137.1 ± 2.2A 91.4 ± 4.0ghijklmnop
6 87.1 ± 2.3MNO 82.8 ± 1.8pqrst
7 74.0 ± 2.5QRS 77.5 ± 1.5t
8 120.5 ± 1.4CDEFGH 85.4 ± 1.7mnopqrst
9 115.8 ± 2.4EFGHI 102.5 ± 4.0ab
10 123.8 ± 1.6BCDE 89.3 ± 1.8ijklmnopqr
11 121.6 ± 3.0CDEFG 103.2 ± 2.6ab
12 86.9 ± 1.8MNO 81.9 ± 1.9qrst
13 127.4 ± 1.6ABCD 91.1 ± 4.0hijklmnop
14 45.5 ± 2.5T 102.8 ± 3.0ab
15 112.3 ± 3.7GHI 103.0 ± 1.7ab
19 99.7 ± 1.0KL 102.9 ± 1.4ab
20 111.4 ± 4.0GHI 101.6 ± 1.6abcd
21 54.4 ± 5.5T 100.6 ± 1.1abcdef
22 76.0 ± 2.0PQR 103.3 ± 1.2ab
27 53.6 ± 1.3T 87.8 ± 2.4klmnopqrs
28 78.7 ± 0.4NOPQR 86.5 ± 2.3lmnopqrs
29 74.4 ± 1.4QRS 87.8 ± 2.4klmnopqrs
30 118.0 ± 4.3DEFGHI 100.5 ± 1.1abcdef
31 80.7 ± 1.1NOPQ 97.0 ± 3.5abcdefghij
32 94.2 ± 2.1LM 90.1 ± 1.5ijklmnopqr
33 85.9 ± 2.4MNOP 96.5 ± 1.8abcdefghijk
34 75.9 ± 2.4PQR 97.5 ± 1.3abcdefghi
35 120.4 ± 2.4CDEFGH 89.9 ± 2.3ijklmnopqr
36 122.7 ± 2.4BCDEF 100.6 ± 0.7abcdef
38W 119.7 ± 2.1CDEFGH 104.0 ± 2.0a
38Y 115.2 ± 3.4EFGHI 90.3 ± 3.3ijklmnopq
44 78.5 ± 2.9NOPQR 82.7 ± 1.6pqrst
45 79.0 ± 1.6NOPQ 87.8 ± 2.8klmnopqrs
49Y 129.3 ± 2.6ABC 93.1 ± 1.3defghijklmn
50 127.0 ± 3.2ABCD 94.6 ± 2.4bcdefghijkl
52 132.2 ± 2.3AB 91.7 ± 6.2fghijklmnop
53 127.8 ± 3.1ABCD 93.5 ± 3.7cdefghijklm
56 65.0 ± 3.1S 99.6 ± 2.5abcdefgh
57 127.9 ± 2.1ABCD 88.0 ± 4.9klmnopqrs
58 68.5 ± 3.8RS 80.1 ± 2.1st
59 48.4 ± 3.7T 84.4 ± 6.6nopqrst
60 127.5 ± 2.3ABCD 92.2 ± 4.2fghijklmno
66 111.3 ± 9.8HIJ 101.2 ± 1.4abcde
67 115.8 ± 2.6EFGHI 101.5 ± 2.3abcde
70 120.1 ± 1.6CDEFGH 102.2 ± 1.0abc
71 123.8 ± 2.6BCDE 92.6 ± 2.7efghijklmn
72 77.4 ± 2.8OPQR 81.3 ± 10.0rst
73 80.2 ± 1.9NOPQ 83.6 ± 4.4opqrst
74 109.3 ± 4.2IJK 89.3 ± 1.9ijklmnopqr
75 78.6 ± 5.2NOPQR 80.0 ± 5.0st
76 112.6 ± 5.1FGHI 88.3 ± 4.3jklmnopqrs
77 118.8 ± 2.8DEFGHI 90.2 ± 2.9ijklmnopqr

Lacticaseibacillus rhamnosus GG (ATCC53103) was used as the positive control.

Different letters indicate a significant difference in bile resistance (p < 0.05).

Different letters indicate a significant difference in pancreatic enzyme resistance (p < 0.05).

Download Excel Table
Gelatinase and urease activities

None of the 12 isolates hydrolyzed gelatin and were considered gelatinase-negative (data not shown). Gelatinase is considered a pathogenic factor in probiotics when it is secreted extracellularly and hydrolyzes or digests gelatin and collagen [19,33–35]. The 12 isolates did not exhibit urease activity (data not shown). Urease activity is an important factor in bacterial pathogenesis. Urease catalyzes the hydrolysis of urea to yield ammonia and carbamate, thereby increasing the pH [20]. Urease is a virulence factor in human and animal infections in the urinary tract or gastrointestinal region [20]. Ammonia production by this enzyme is related to renal failure and hepatic failure [36]. The results of this study indicated that none of the 12 isolates produced gelatinase or urease.

Antibiotic resistance

Among the 12 isolates, five (19, 20, 30, 36, and 67) showed tetracycline resistance (Table 4). Antibiotic resistance is an emerging issue, as antibiotic resistance genes can be transferred to commensals or pathogens in the gut [37]. Therefore, it is necessary to confirm the antibiotic resistance ability of probiotic bacteria [38,39].

Table 4. Antibiotic resistance of 12 lactic acid bacteria isolates
Isolate Minimum inhibitory concentration (mg/L)
Ampicillin Gentamicin Kanamycin Streptomycin Erythromycin Clindamycin Tetracycline Chloramphenicol
2 2 ≤ 0.25 16 8 ≤ 0.25 ≤ 0.12 4 ≤ 2
9 ≤ 1 ≤ 0.25 16 16 ≤ 0.25 ≤ 0.12 8 ≤ 2
11 ≤ 1 ≤ 0.25 16 16 ≤ 0.25 ≤ 0.12 8 ≤ 2
15 ≤ 1 ≤ 0.25 8 8 ≤ 0.25 ≤ 0.12 8 ≤ 2
19 2 0.5 16 16 ≤ 0.25 ≤ 0.12 161) ≤ 2
20 2 0.5 16 16 ≤ 0.25 ≤ 0.12 161) ≤ 2
30 2 ≤ 0.25 16 16 ≤ 0.25 ≤ 0.12 161) ≤ 2
36 ≤ 1 ≤ 0.25 16 16 ≤ 0.25 ≤ 0.12 161) ≤ 2
38 W ≤ 1 ≤ 0.25 8 8 ≤ 0.25 ≤ 0.12 8 ≤ 2
66 2 0.5 16 16 ≤ 0.25 ≤ 0.12 8 ≤ 2
67 ≤ 1 ≤ 0.25 8 16 ≤ 0.25 ≤ 0.12 161) ≤ 2
70 2 0.5 16 16 ≤ 0.25 ≤ 0.12 8 ≤ 2
EFSA Cut-off2) 4 16 64 64 1 1 8 4

The value more than the EFSA cut off.

Cut-off values established by EFSA [25].

Download Excel Table
Effect of isolates on infectious diarrhea
Antimicrobial effect against diarrheal pathogens

Twelve lactic acid bacteria isolates were selected based on the results of bile and pancreatic enzyme resistance, gelatinase and urease activity analysis, and antibiotic resistance. To select probiotic strains for pigs, the antimicrobial activities of the isolate were examined to diarrheal pathogens such as C. coli, C. perfringens, E. coli, and Salmonella isolated from pigs [40–42]. The antimicrobial activities of the 12 isolates against pathogens are presented in Table 5. The diameters of the inhibition zones of the isolates against C. coli, C. perfringens, E. coli, and Salmonella strains were 16.9–22.2 mm, 13.1–24.7 mm, 14.5–23.3 mm, and 14.4–23.7 mm, respectively. The diameters of the inhibition zones for the PCs for C. coli,C. perfringens, E. coli, and Salmonella were 10.3–12.2 mm, 8.7–13.8 mm, 10.3–11.7 mm, and 8.7–14.0 mm, respectively. These results show that the aforementioned 12 isolates exhibit a high antimicrobial activity against diarrheal pathogens. Isolates 15, 19, and 38W showed significantly higher (p < 0.05) antimicrobial activities than the other isolates, with isolate 38W exhibiting the highest antimicrobial activity. C. coli, C. perfringens, E. coli, and Salmonella infections are common causes of severe diarrhea in weaning pigs [43]; these results suggest that isolates 15, 19, and 38W could be candidate probiotics for further analysis.

Table 5. Antimicrobial effects of 12 lactic acid bacteria isolates against the diarrheal pathogens Escherichia coli, Salmonella Typhimurium, Campylobacter coli, and Clostridium perfringens1)
Isolate E. coli strains S. Typhimurium strains C. coli strains C. perfringens strains
KVCC-BA0001423 KVCC-BA0001823 KVCC-BA1600302 KVCC-BA2000160 KVCC-BA2000161 KVCC-BA1800493 KVCC-BA1800494 KVCC-BA1800595 KVCC-BA1900009 KVCC-BA1900010 KVCC-BA1900011 KVCC-BA1700250
PC 1 11.5 ± 1.2e 11.1 ± 1.8d 11.7 ± 0.8c 12.8 ± 1.3ef 11.8 ± 1.2c 12.2 ± 1.8c 10.9 ± 0.7d 10.5 ± 1.0d 11.0 ± 1.4e 10.3 ± 0.8e 11.7 ± 2.1df 12.1 ± 0.8c
PC 2 10.3 ± 0.8e 10.8 ± 0.4d 11.5 ± 0.5c 8.7 ± 1.0f 11.8 ± 1.9c 10.3 ± 0.7c 12.0 ± 0.0cd 11.7 ± 0.4cd 9.3 ± 0.4f 9.6 ± 0.4e 8.7 ± 1.0f 9.3 ± 1.3d
PC 3 11.3 ± 2.0e 10.8 ± 0.8d 11.7 ± 0.8c 14.0 ± 1.2de 12.0 ± 0.6c 11.8 ± 1.2c 10.8 ± 0.8d 11.2 ± 0.8d 10.0 ± 0.9e 13.3 ± 1.5de 13.8 ± 1.7de 12.3 ± 1.5c
2 16.5 ± 1.5d 17.3 ± 2.2abc 16.6 ± 1.1bc 19.0 ± 1.7bc 17.0 ± 2.1abc 17.7 ± 2.3b 18.2 ± 1.8abc 18.6 ± 1.6ab 15.5 ± 1.4cd 18.8 ± 2.1bc 17.5 ± 1.4bcd 15.9 ± 1.6b
9 18.1 ± 1.2cd 16.2 ± 1.1bc 15.3 ± 1.1bc 16.5 ± 1.9cde 14.4 ± 1.2bc 18.4 ± 1.7ab 18.0 ± 1.6abc 18.2 ± 1.2ab 15.7 ± 2.1bcd 18.3 ± 1.7bcd 17.3 ± 1.7bcd 16.9 ± 1.0b
11 20.0 ± 1.4abc 16.8 ± 1.6bc 17.2 ± 2.9ab 18.2 ± 2.7bcd 17.3 ± 3.6abc 18.9 ± 1.7ab 19.5 ± 2.4ab 19.2 ± 1.1ab 15.2 ± 1.7cd 20.9 ± 2.0abc 19.2 ± 1.7abc 21.6 ± 1.6a
15 20.9 ± 1.6abc 18.3 ± 1.9abc 17.8 ± 2.4ab 20.0 ± 3.7abc 18.9 ± 1.3ab 19.5 ± 1.0ab 20.0 ± 0.6ab 20.4 ± 1.7ab 18.8 ± 2.9ab 21.5 ± 2.8abc 19.7 ± 1.5ab 23.3 ± 1.3a
19 20.7 ± 3.0abc 18.7 ± 2.1abc 19.0 ± 1.8ab 21.7 ± 2.3ab 19.8 ± 1.3ab 20.8 ± 1.0ab 19.9 ± 1.2ab 20.6 ± 1.2ab 17.8 ± 2.6abc 22.7 ± 2.5ab 20.4 ± 2.7ab 22.5 ± 1.9a
20 20.9 ± 1.6abc 19.1 ± 2.8abc 19.3 ± 2.2ab 18.9 ± 1.3bc 17.3 ± 0.9abc 19.3 ± 1.1ab 19.5 ± 1.8ab 20.2 ± 1.1ab 16.2 ± 1.2abcd 21.0 ± 3.0abc 19.1 ± 2.3bc 22.0 ± 1.2a
30 21.8 ± 1.7ab 20.4 ± 2.8de 19.3 ± 2.2ab 20.0 ± 2.8abc 18.8 ± 3.8ab 19.3 ± 1.2ab 18.8 ± 0.9ab 20.2 ± 1.6ab 17.1 ± 1.7abc 22.7 ± 3.8ab 19.7 ± 2.5ab 22.2 ± 1.5a
36 18.2 ± 1.5cd 18.5 ± 1.0abc 19.4 ± 2.2ab 19.6 ± 2.1abc 18.7 ± 1.2ab 17.9 ± 1.4ab 18.6 ± 2.3ab 17.6 ± 1.7b 16.2 ± 1.6abcd 20.3 ± 2.3abc 18.0 ± 2.0bc 17.3 ± 0.9b
38W 23.3 ± 2.2a 21.7 ± 1.6a 21.9 ± 3.2a 23.7 ± 1.0a 23.2 ± 3.8a 22.0 ± 1.4a 22.0 ± 2.1a 22.2 ± 1.5a 19.3 ± 1.9a 24.7 ± 3.4a 22.8 ± 1.5a 24.3 ± 1.4a
66 18.2 ± 3.1cd 15.4 ± 1.4c 14.5 ± 1.9bc 17.1 ± 2.6cde 13.9 ± 3.1bc 17.5 ± 1.8b 16.9 ± 2.2bc 17.3 ± 3.0bc 13.1 ± 1.1de 18.7 ± 1.2bcd 15.5 ± 1.8cd 17.1 ± 1.5b
67 18.3 ± 2.1bcd 17.1 ± 0.9bc 16.3 ± 1.7bc 17.1 ± 2.7cde 17.1 ± 0.9abc 18.4 ± 1.9ab 17.8 ± 2.1abc 18.3 ± 1.8ab 14.8 ± 1.3cd 18.2 ± 1.5bcd 17.0 ± 2.4bcd 16.1 ± 1.2b
70 17.9 ± 2.1cd 16.3 ± 1.0bc 17.1 ± 1.8ab 18.1 ± 2.5bcd 17.3 ± 3.2abc 18.6 ± 1.3ab 17.8 ± 1.7abc 18.9 ± 2.0ab 15.8 ± 1.2bcd 16.8 ± 2.5cd 17.5 ± 1.0bcd 17.8 ± 1.6b

Values are expressed as inhibition zone (mm); mean ± SD.

Different letters in a column indicate a significant difference (p < 0.05).

PC; commercial probiotics for feeding.

Download Excel Table
Paracellular permeability

Paracellular permeability was measured FD-4 transport in order to evaluate the protective effects of the three isolates (15, 19, and 38W) on epithelial integrity (Fig. 1). The paracellular permeability was significantly increased (p < 0.05) in the EC group compared to that in the non-E. coli infected groups (non-treated, PC, LAB15, LAB19, and LAB38W); however, the groups LAB15+EC, LAB19+EC, and LAB38W+EC, which were infected with E. coli and treated with isolates 15, 19, and 38W, had lower permeability than the EC group (Fig. 1). The permeability of the LAB38W+EC group was similar to that of the LAB38W group. These results indicate that isolate 38W might protect the gut barrier from increased permeability caused by E. coli infection. An imbalance between the abundance of beneficial and pathogenic bacteria in the gut increases the mucosal epithelial permeability, leading to chronic inflammatory diseases [44]. Several external factors, including bacteria, affect intestinal permeability. Furthermore, the primary pathogen in piglets is E. coli, which caused an increase in the gut permeability [45]. Acute and persistent diarrhea are associated with increased intestinal permeability, and repeated diarrhea results in malnutrition [46]. Thus, epithelial permeability must be lowered to maintain and enhance intestinal barrier function [47]. Some lactic acid bacteria reduced pathogen-induced permeability of the small intestine [48, 49, 50, 51]. Our results indicate that isolate 38W might alleviate the epithelial damage caused by diarrheal pathogens.

jast-67-4-868-g1
Fig. 1. Paracellular permeability of HT-29 cells treated with lactic acid bacteria isolates. Non-treated, Dulbecco’s modified Eagle’s medium; EC, Escherichia coli NCCP11142; PC, Lacticaseibacillus rhamnosus GG ATCC53103. a-gDifferent letters indicate significant differences (p < 0.05).
Download Original Figure
Expression of genes encoding TJ proteins

The relative expression of genes encoding TJ proteins in HT-29 cells significantly reduced after E. coli infection. However, the PC+EC, LAB15+EC, LAB19+EC, and LAB38W+EC groups did not show this reduction (Fig. 2). TJ proteins play crucial roles in maintaining the integrity and function of the gut barrier [47, 52]. They include transmembrane proteins, such as claudin and occludin, and cytoplasmic scaffolding proteins, such as ZO-1, which have linking and sealing effects [52]. TJ protein expression decreases during weaning, thereby reducing the barrier integrity [53]. Reduced barrier integrity facilitates pathogen penetration and allows toxins to enter the body [54]. Thus, it is important to increase TJ protein expression. Particularly, the LAB38W+EC group showed expression levels of genes encoding TJ proteins (claudin-1, ZO-1, and occludin) similar to those in the E. coli untreated group (Fig. 2). This result indicates that isolate 38W might protect the gut barrier from E. coli infection. Similarly, various other probiotic strains have been shown to protect and maintain these barriers in vivo and in vitro [54, 55, 56]. These findings indicate that isolate 38W might be an appropriate probiotic that enhances intestinal epithelial resistance to pathogens by increasing the expression of TJ proteins.

jast-67-4-868-g2
Fig. 2. Relative gene expression levels of (A) claudin-1, (B) ZO-1, and (C) occludin in HT-29 cells treated with lactic acid bacteria isolates. EC, Escherichia coli NCCP11142; PC, Lacticaseibacillus rhamnosus GG ATCC53103. a–eDifferent letters indicate significant differences (p < 0.05).
Download Original Figure
Genomic characteristics of probiotics
De novo sequencing

The whole genome was obtained by sequencing the DNA of isolates 15, 19, and 38W using de novo assembly (data not shown). The de novo assembly yielded six contigs for isolate 15; the sizes were 1,797,082 (contig 1), 56,451 (contig 2), 53,170 (contig 3), 23,413 (contig 4), 18,038 (contig 5), and 15,252 bp (contig 6). The guanine-cytosine (GC) contents of contigs 1, 2, 3, 4, 5, and 6 were 37.28%, 39.74%, 38.91%, 36.43%, 37.61%, and 39.14% respectively. Contig 1 of isolate 15 was identified as the chromosome of P. pentosaceus using BLAST 2.9.0+ and the NCBI database. Contigs 2, 3, 4, 5, and 6 from isolate 15 were identified as plasmids. Isolate 19 had three contigs; the sizes were 1,795,482 (contig 1), 65,469 (contig 2), and 36,563 bp (contig 3). The GC contents of contigs 1, 2, and 3 were 37.31%, 39.67%, and 35.97%, respectively. Contig 1 of isolate 19 was identified as P. pentosaceus chromosome. Contigs 2 and 3 of isolate 19 were identified as plasmids. Isolate 38W had two contigs, with sizes of 1,809,731 (contig 1) and 12,226 bp (contig 2). The GC contents of contigs 1 and 2 of isolate 38W were 37.32% and 36.19%, respectively. Contig 1 was identified as P. pentosaceus chromosome, and contig 2 was identified as a plasmid. Accordingly, isolates 15, 19, and 38W were named as Pediococcus pentosaceus SMFM2016-NK1, Pediococcus pentosaceus SMFM2016-YK1, and Pediococcus pentosaceus SMFM2016-WK1, respectively; their whole-genome sequences were registered at the NCBI under the accession numbers NZ_CP127866.1, NZ_CP127868.1, and NZ_CP127867.1, respectively.

Gene annotation and prediction

Among the whole-genome sequences of the three isolates, only contig 1 for each isolate had more than 1,000,000 bp (Figs. 3, 4, and 5). Thus, contig 1 (chromosome) was identified as the complete genome, and contig 1 of each isolate was analyzed. Contig 1 of P. pentosaceus SMFM2016-NK1 comprised 1,761 CDS, 15 rRNAs, and 55 tRNAs. Contig 1 of P. pentosaceus SMFM2016-YK1 comprised 1,749 CDSs, 15 rRNAs, and 57 tRNAs. Contig 1 of P. pentosaceus SMFM2016-WK1 comprised 1,811 CDSs, 15 rRNAs, and 55 tRNAs (Figs. 3, 4, and 5). The predicted functional genes were divided into three gene ontology categories (biological processes, cellular components, and molecular functions) (Figs. 3B, 4B, and 5B). The transcripts of P. pentosaceus SMFM2016-NK1 were found to contain 3,406 biological processes, 1,837 cellular components, and 1,880 molecular functions based on multiple gene ontologies. The transcripts of P. pentosaceus SMFM2016-YK1 were found to contain 3,350 biological processes, 2,156 cellular components, and 1,848 molecular functions. The transcripts of P. pentosaceus SMFM2016-WK1 contained 3,237 biological processes, 1,828 cellular components, and 1,794 molecular function transcription factors. These results indicate that the three P. pentosaceus isolates possess different genes and thus, exhibit distinct biological functions.

jast-67-4-868-g3
Fig. 3. Chromosomal genome properties of Pediococcus pentosaceus SMFM2016-NK1. (A) Overall features of the genome (outer scale; base pairs, the first [the outer-most; blue] and second pink ring; forward and reverse open reading frames [ORFs] by gene annotation, the third ring; coding sequences, the fourth ring; rRNA values, the fifth ring; tRNA values, the sixth ring; GC contents, the inner most; GC skew) and (B) gene ontology classification (biological process, cellular component, and molecular function) via gene prediction and annotation for Pediococcus pentosaceus SMFM2016-NK1. CDS, coding sequences; GC, guanine + cytosin.
Download Original Figure
jast-67-4-868-g4
Fig. 4. Chromosomal genome properties of Pediococcus pentosaceus SMFM2016-YK1. (A) Overall features of the genome (outer scale; base pairs, the first [the outer-most; blue] and second pink ring; forward and reverse open reading frames [ORFs] by gene annotation, the third ring; coding sequences, the fourth ring; rRNA values, the fifth ring; tRNA values, the sixth ring; GC contents, the inner most; GC skew) and (B) gene ontology classification (biological process, cellular component, and molecular function) via gene prediction and annotation for Pediococcus pentosaceus SMFM2016-YK1. CDS, coding sequences; GC, guanine + cytosin.
Download Original Figure
jast-67-4-868-g5
Fig. 5. Chromosomal genome properties of Pediococcus pentosaceus SMFM2016-WK1. (A) Overall features of the genome (outer scale; base pairs, the first [the outer-most; blue] and second pink ring; forward and reverse open reading frames [ORFs] by gene annotation, the third ring; coding sequences, the fourth ring; rRNA values, the fifth ring; tRNA values, the sixth ring; GC contents, the inner most; GC skew) and (B) gene ontology classification (biological process, cellular component, and molecular function) via gene prediction and annotation for Pediococcus pentosaceus SMFM2016-WK1. CDS, coding sequences; GC, guanine + cytosin; GO, gene ontology.
Download Original Figure
Genomic comparison with other probiotic bacteria

The genetic characteristics of P. pentosaceus strains SMFM2016-NK1, SMFM2016-YK1, and SMFM2016-WK1 were compared with those of 15 reference strains in the NCBI database. The ANI values obtained indicated that the P. pentosaceus strains SMFM2016-NK1, SMFM2016-YK1, and SMFM2016-WK1 were the closest to P. pentosaceus SS1-3 (99.93%), P. pentosaceus SRCM102734 (99.69%), and P. pentosaceus SL4 (99.43%), respectively (Fig. 6). According to the phylogenetic tree derived from ANI, the P. pentosaceus strains SMFM2016-NK1, SMFM2016-YK1, and SMFM2016-WK1 were genetically distinct from the other P. pentosaceus strains (Table 6, Figs. 6 and 7).

Table 6. Comparison of the chromosomal properties of Pediococcus pentosaceus strains registered in the NCBI database
Chromosomal properties Strain
SMFM2016_NK1 SMFM2016_YK1 SMFM2016_WK1 ATCC 25745 GDIA S001 JQI-7 KCCM 40703 SL001 SL4 SRCM 100194 SRCM 100892 SRCM 102734 SRCM 102736 SRCM 102738 SRCM 102739 SRCM 102740 SS1-3 Wikim20
Genome size (Mb) 1.85 1.79 1.72 1.83 1.83 1.73 1.76 1.92 1.79 1.87 2.00 1.71 1.81 1.88 1.90 1.88 1.84 1.83
GC content (%) 38.26 37.31 36.76 37.40 37.10 37.20 37.20 37.44 37.30 37.38 37.27 37.40 37.39 37.41 37.37 37.41 37.28 37.26
tRNA 55 57 55 55 56 56 55 56 51 55 56 56 56 56 56 56 55 55
rRNA 15 15 15 15 15 5 15 15 15 15 15 15 15 15 15 15 15 15
ANI (%)
 NK1 - 98.82 98.77 98.88 98.87 98.91 98.91 98.85 98.82 98.86 98.66 98.95 98.95 98.90 98.90 98.90 99.93 98.85
 YK1 98.82 - 98.91 99.13 99.01 98.94 99.01 98.89 98.98 99.05 98.74 99.69 98.97 99.12 99.12 99.12 99.02 99.07
 WK1 98.77 98.91 - 98.85 98.89 99.02 98.96 99.03 99.43 98.79 98.81 98.97 99.06 98.91 98.91 98.91 98.81 98.92
Source Kimchi Kimchi Kimchi - Plant feed material Fermented dairy Sakemash Soil Sausages Food Food Doenjang Chong-gugjang Chong-gugjang Chong-gugjang Chong-gugjang Adult feces Kimchi
Location Korea Korea Korea - China China Japan China Denmark Korea Korea Korea Korea Korea Korea Korea Korea Korea

GC, guanine + cytosine; ANI, Average Nucleotide Identity.

Download Excel Table
jast-67-4-868-g6
Fig. 6. Phylogenetic tree based on the average nucleotide identity (ANI) for Pediococcus pentosaceus isolates.
Download Original Figure
jast-67-4-868-g7
Fig. 7. Average nucleotide identity (ANI) analysis results of Pediococcus pentosaceus isolates.
Download Original Figure
Antibiotic resistance and antimicrobial genes

Through mapping and predicted gene analysis, P. pentosaceus SMFM2016-YK1, which was found to be resistant to tetracycline in the MIC analysis, was identified as a carrier of the tetM gene (tetracycline resistance ribosomal protection protein) (data not shown). The SMFM2016-NK1 and SMFM2016-WK1 strains, which showed no tetracycline resistance in the MIC analysis, were found to harbor the tetA gene (tetracycline efflux gene). The difference in the results of MIC and predicted gene analysis could be due to the low expression levels of genes encoding tetracycline resistance. Lim et al. [57] observed differences in the MICs of isolates with the same resistance gene and found that the expression of resistance-related genes was significantly different among the isolates, resulting in different MICs. Antimicrobial substances produced by lactic acid bacteria include lactic acid, organic acids, ammonia, and bacteriocins [58,59]. Bacteriocins are antibacterial extracellularly secreted peptides or proteins, and bacteriocin-producing bacteria are capable of antimicrobial activity [60,61]. Pediocin, sakacin, nisin, and leucocin are some well-known bacteriocins; the BceA, BceB, and MccF genes are involved in pediocin synthesis [59,62]. P. pentosaceus SMFM2016-NK1 harbors bacteriocin-related genes (YheH, ytrF, BceA, BceB, and MccF) and organic acid-related genes (rackA, ALS,ccl,larA, and ldh) (data not shown). P. pentosaceus SMFM2016-YK1 harbors bacteriocin-related genes (YheH, ytrF, BceA,BceB, entK, lcnA, MccF, and skgD) and organic acid-related genes (ackA, CcpA,ALS, ALS1, aldC, ccl, ldhA, lldP, larA, larR, and ldh) (data not shown). P. pentosaceus SMFM2016-WK1 harbors bacteriocin-related genes (YheH, ytrF, BceA, BceB, and MccF) and organic acid-related genes (ackA, CcpA, ALS, aldC,ccl, ldhA, larA, larR, and ldh) (data not shown). Overall, our results indicate that these antimicrobial factors may inhibit the growth of diarrheal pathogens, as shown in Table 5.

CONCLUSION

Among 51 lactic acid bacteria strains, P. pentosaceus SMFM2016-NK1, SMFM2016-YK1, and SMFM2016-WK1 exhibited higher antimicrobial activity against diarrhea-causing pathogens. Of the three isolates, P. pentosaceus SMFM2016-WK1 was the most effective on protecting the gut barrier from increased permeability caused by E. coli with the increased gene expression associated with TJ proteins. These results suggest that among the examined isolates, P. pentosaceus SMFM2016-WK1 might be a suitable strain to control diarrheal pathogens isolated from pigs. However, since these results were obtained only from in vitro experiments, the implication of the results from this study should be limited. Thus, a further study is necessary.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This research was supported by grants from the Animal and Plant Quarantine Agency, Ministry of Agriculture, Food and Rural Affairs, Korea (Z-1543081-2020-22-0103).

Acknowledgements

Not applicable.

Availability of data and material

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Authors’ contributions

Conceptualization: Yoon Y.

Data curation: Cho E, Yoo Y.

Formal analysis: Cho E, Yoo Y, Yoon Y.

Methodology: Cho E, Yoo Y, Yoon Y.

Software: Cho E, Yoo Y.

Validation: Cho E, Yoo Y.

Investigation: Cho E, Yoo Y.

Writing - original draft: Cho E, Yoo Y.

Writing - review & editing: Cho E, Yoo Y, Yoon Y.

Ethics approval and consent to participate

This article does not require IRB/IACUC approval because there are no human and animal participants.

References

1.

Ruiz VLA, Bersano JG, Carvalho AF, Catroxo MHB, Chiebao DP, Gregori F, et al. Case-control study of pathogens involved in piglet diarrhea. BMC Res Notes. 2016; 9:22

2.

Thomson JR, Friendship RM. Digestive system.In In: Zimmerman JJ, Karriker LA, Ramirez A, Schwartz KJ, Stevenson GW, Zhang J, editors.editors Diseases of swine. 11th ed Hoboken, NJ: Wiley & Sons. 2019; p. 234-63

3.

Kirchhelle C. Pharming animals: a global history of antibiotics in food production (1935–2017). Palgrave Commun. 2018; 4:96

4.

Fuller R. Probiotics in man and animals. J Appl Bacteriol. 1989; 66:365-78

5.

Medellin-Peña MJ, Wang H, Johnson R, Anand S, Griffiths MW. Probiotics affect virulence-related gene expression in Escherichia coli O157:H7. Appl Environ Microbiol. 2007; 73:4259-67

6.

de Melo Pereira GV, de Oliveira Coelho B, Magalhães Júnior AI, Thomaz-Soccol V, Soccol CR. How to select a probiotic? A review and update of methods and criteria. Biotechnol Adv. 2018; 36:2060-76

7.

Wulandari E, Yurmiati H, Subroto T, Suradi K. Quality and probiotic lactic acid bacteria diversity of rabbit meat bekasam-fermented meat. Food Sci Anim Resour. 2020; 40:362-76

8.

Zhang Y, Yao D, Huang H, Zhang M, Sun L, Su L, et al. Probiotics increase intramuscular fat and improve the composition of fatty acids in Sunit sheep through the adenosine 5′-monophosphate-activated protein kinase (AMPK) signaling pathway. Food Sci Anim Resour. 2023; 43:805-25

9.

Lee S, Eom S, Lee J, Pyeon M, Kim K, Choi KY, et al. Probiotics that ameliorate cognitive impairment through anti-inflammation and anti-oxidation in mice. Food Sci Anim Resour. 2023; 43:612-24

10.

Chatterjee A, Bhattacharya H, Kandwal A. Probiotics in periodontal health and disease. J Indian Soc Periodontol. 2011; 15:23-8

11.

Barba-Vidal E, Martín-Orúe SM, Castillejos L. Practical aspects of the use of probiotics in pig production: a review. Livest Sci. 2019; 223:84-96

12.

Kang J, Lee JJ, Cho JH, Choe J, Kyoung H, Kim SH, et al. Effects of dietary inactivated probiotics on growth performance and immune responses of weaned pigs. J Anim Sci Technol. 2021; 63:3

13.

Zimmermann JA, Fusari ML, Rossler E, Blajman JE, Romero-Scharpen A, Astesana DM, et al. Effects of probiotics in swines growth performance: a meta-analysis of randomised controlled trials. Anim Feed Sci Technol. 2016; 219:280-93

14.

Anadón A, Martínez-Larrañaga MR, Aranzazu Martínez MA. Probiotics for animal nutrition in the European Union. Regulation and safety assessment. Regul Toxicol Pharmacol. 2006; 45:91-5

15.

Guo H, Fan L, Ding L, Yang W, Zang C, Guan H. Separation and purification of antioxidant peptide from fermented whey protein by Lactobacillus rhamnosus B2-1. Food Sci Anim Resour. 2023; 43:10-24

16.

Widodo W, Kusumaningrum HRP, Wihadmadyatami H, Wicaksana AL. Milk fermented with Pediococcus acidilactici strain BE improves high blood glucose levels and pancreatic beta-cell function in diabetic rats. Food Sci Anim Resour. 2023; 43:170-83

17.

Jang HJ. Potential use of lactic acid bacteria isolated from kimchi as probiotics. Master’s thesis, Seoul, Korea: Sookmyung Women’s University. 2018

18.

Yasmin I, Saeed M, Khan WA, Khaliq A, Chughtai MFJ, Iqbal R, et al. In vitro probiotic potential and safety evaluation (hemolytic, cytotoxic activity) of Bifidobacterium strains isolated from raw camel milk. Microorganisms. 2020; 8:354

19.

Leboffe MJ, Pierce BE. Microbiology: laboratory theory and application. 3rd ed Englewood, CO: Morton. 2015

20.

Collins CM, D’Orazio SEF. Bacterial ureases: structure, regulation of expression and role in pathogenesis. Mol Microbiol. 1993; 9:907-13

21.

Casey PG, Casey GD, Gardiner GE, Tangney M, Stanton C, Ross RP, et al. Isolation and characterization of anti‐Salmonella lactic acid bacteria from the porcine gastrointestinal tract. Lett Appl Microbiol. 2004; 39:431-8

22.

Plessas S, Nouska C, Karapetsas A, Kazakos S, Alexopoulos A, Mantzourani I, et al. Isolation, characterization and evaluation of the probiotic potential of a novel Lactobacillus strain isolated from feta-type cheese. Food Chem. 2017; 226:102-8

23.

Ann S, Choi Y, Yoon Y. Comparative genomic analysis and physiological properties of Limosilactobacillus fermentum SMFM2017-NK2 with ability to inflammatory bowel disease. Microorganisms. 2023; 11:547

24.

Brink B. Urease test protocol [Internet]. American Society Microbiology. 2010cited 2022 Oct 5https://asm.org/getattachment/ac4fe214-106d-407c-b6c6-e3bb49ac6ffb/urease-test-protocol-322

25.

EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP), Rychen G, Aquilina G, Azimonti G, Bampidis V, Bastos ML, et al. Guidance on the characterisation of microorganisms used as feed additives or as production organisms. EFSA J. 2018; 16e05206

26.

Ha J, Seo Y, Cho E, Choi S, Kim H, Yoon Y. Improvement of the detection efficiency of 3M™ molecular detection system for Campylobacter in poultry using nitrogen-doped carbon nanodots. J Microbiol Methods. 2021; 184:106211

27.

Choi Y, Park E, Kim S, Ha J, Oh H, Kim Y, et al. Alleviation of periodontal disease using Lactobacillus curvatus SMFM2016-NK. J Funct Foods. 2021; 83:104531

28.

Lin PW, Nasr TR, Berardinelli AJ, Kumar A, Neish AS. The probiotic Lactobacillus GG may augment intestinal host defense by regulating apoptosis and promoting cytoprotective responses in the developing murine gut. Pediatr Res. 2008; 64:511-6

29.

Patel RM, Myers LS, Kurundkar AR, Maheshwari A, Nusrat A, Lin PW. Probiotic bacteria induce maturation of intestinal claudin 3 expression and barrier function. Am J Pathol. 2012; 180:626-35

30.

Wang Z, Wang L, Chen Z, Ma X, Yang X, Zhang J, et al. In vitro evaluation of swine-derived Lactobacillus reuteri: probiotic properties and effects on intestinal porcine epithelial cells challenged with enterotoxigenic Escherichia coli K88. J Microbiol Biotechnol. 2016; 26:1018-25

31.

Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002; 30e36

32.

Delcher AL, Bratke KA, Powers EC, Salzberg SL. Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics. 2007; 23:673-9

33.

Gupta A, Sharma N. Characterization of potential probiotic lactic acid bacteria- Pediococcus acidilactici Ch-2 isolated from Chuli- A traditional apricot product of Himalayan region for the production of novel bioactive compounds with special therapeutic properties. J Food Microbiol Saf Hyg. 2017; 2:119

34.

Oruc O, Cetin O, Onal Darilmaz D, Yüsekdag ZN. Determination of the biosafety of potential probiotic Enterococcus faecalis and Enterococcus faecium strains isolated from traditional white cheeses. LWT. 2021; 148:111741

35.

Vergis EN, Shankar N, Chow JW, Hayden MK, Snydman DR, Zervos MJ, et al. Association between the presence of enterococcal virulence factors gelatinase, hemolysin, and enterococcal surface protein and mortality among patients with bacteremia due to Enterococcus faecalis. Clin Infect Dis. 2002; 35:570-5

36.

Kosikowska P, Berlicki Ł. Urease inhibitors as potential drugs for gastric and urinary tract infections: a patent review. Expert Opin Ther Pat. 2011; 21:945-57

37.

Selvin J, Maity D, Sajayan A, Kiran GS. Revealing antibiotic resistance in therapeutic and dietary probiotic supplements. J Glob Antimicrob Resist. 2020; 22:202-5

38.

Temmerman R, Pot B, Huys G, Swings J. Identification and antibiotic susceptibility of bacterial isolates from probiotic products. Int J Food Microbiol. 2003; 81:1-10

39.

Imperial ICVJ, Ibana JA. Addressing the antibiotic resistance problem with probiotics: reducing the risk of its double-edged sword effect. Front Microbiol. 2016; 7:1983

40.

Bratz K, Bücker R, Gölz G, Zakrzewski SS, Janczyk P, Nöckler K, et al. Experimental infection of weaned piglets with Campylobacter coli – excretion and translocation in a pig colonisation trial. Vet Microbiol. 2013; 162:136-43

41.

Lee D, Jang G, Min KC, Lee IH, Won H, Yoon IJ, et al. Coinfection with porcine epidemic diarrhea virus and Clostridium perfringens type A enhances disease severity in weaned pigs. Arch Virol. 2023; 168:166

42.

Pluske JR, Turpin DL, Sahibzada S, Pineda L, Han Y, Collins A. Impacts of feeding organic acid-based feed additives on diarrhea, performance, and fecal microbiome characteristics of pigs after weaning challenged with an enterotoxigenic strain of Escherichia coli. Transl Anim Sci. 2021; 5:txab212

43.

Scallan E, Hoekstra RM, Angulo FJ, Tauxe RV, Widdowson MA, Roy SL, et al. Foodborne illness acquired in the United States—major pathogens. Emerg Infect Dis. 2011; 17:7-15

44.

Kozakova H, Schwarzer M, Tuckova L, Srutkova D, Czarnowska E, Rosiak I, et al. Colonization of germ-free mice with a mixture of three Lactobacillus strains enhances the integrity of gut mucosa and ameliorates allergic sensitization. Cell Mol Immunol. 2016; 13:251-62

45.

Haroun E, Kumar PA, Saba L, Kassab J, Ghimire K, Dutta D, et al. Intestinal barrier functions in hematologic and oncologic diseases. J Transl Med. 2023; 21:233

46.

Boaz RT, Joseph AJ, Kang G, Bose A. Intestinal permeability in normally nourished and malnourished children with and without diarrhea. Indian Pediatr. 2013; 50:152-3

47.

Anderson RC, Cookson AL, McNabb WC, Park Z, McCann MJ, Kelly WJ, et al. Lactobacillus plantarum MB452 enhances the function of the intestinal barrier by increasing the expression levels of genes involved in tight junction formation. BMC Microbiol. 2010; 10:316

48.

Ayu IL, Ha HK, Yang DH, Lee WJ, Lee MR. Encapsulation of Lactobacillus rhamnosus GG using milk protein-based delivery systems: effects of reaction temperature and holding time on their physicochemical and functional properties. Food Sci Anim Resour. 2021; 41:894-904

49.

Gupta P, Andrew H, Kirschner BS, Guandalini S. Is lactobacillus GG helpful in children with Crohn’s disease? Results of a preliminary, open-label study. J Pediatr Gastroenterol Nutr. 2000; 31:453-7

50.

Klingberg TD, Pedersen MH, Cencic A, Budde BB. Application of measurements of transepithelial electrical resistance of intestinal epithelial cell monolayers to evaluate probiotic activity. Appl Environ Microbiol. 2005; 71:7528-30

51.

Sherman PM, Johnson-Henry KC, Yeung HP, Ngo PSC, Goulet J, Tompkins TA. Probiotics reduce enterohemorrhagic Escherichia coli O157:H7- and enteropathogenic E. coli O127:H6-induced changes in polarized T84 epithelial cell monolayers by reducing bacterial adhesion and cytoskeletal rearrangements. Infect Immun. 2005; 73:5183-8

52.

Suzuki T. Regulation of intestinal epithelial permeability by tight junctions. Cell Mol Life Sci. 2013; 70:631-59

53.

Zhao Y, Qin G, Sun Z, Che D, Bao N, Zhang X. Effects of soybean agglutinin on intestinal barrier permeability and tight junction protein expression in weaned piglets. Int J Mol Sci. 2011; 12:8502-12

54.

Wang J, Ji H, Wang S, Liu H, Zhang W, Zhang D, et al. Probiotic Lactobacillus plantarum promotes intestinal barrier function by strengthening the epithelium and modulating gut microbiota. Front Microbiol. 2018; 9:1953

55.

Wu QX, Xu X, Xie Q, Tong WY, Chen Y. Evaluation of chitosan hydrochloride-alginate as enteric micro-probiotic-carrier with dual protective barriers. Int J Biol Macromol. 2016; 93:665-71

56.

Yang H, Rao JN, Wang JY. Posttranscriptional regulation of intestinal epithelial tight junction barrier by RNA-binding proteins and microRNAs. Tissue Barriers. 2014; 2e28320

57.

Lim CS, Lee YS, Kahng HY, Ahn S, Jung JS. Resistance genes in high-level streptomycin resistant Escherichia coli isolated from shellfish. Korean J Microbiol. 2018; 54:228-36

58.

Anand SK, Srinivasan RA, Rao LK. Antibacterial activity associated with Bifidobacterium bifidum. Cult Dairy Prod J. 1984; 35:527-9

59.

Klaenhammer TR. Bacteriocins of lactic acid bacteria. Biochimie. 1988; 70:337-49

60.

Cavera VL, Arthur TD, Kashtanov D, Chikindas ML. Bacteriocins and their position in the next wave of conventional antibiotics. Int J Antimicrob Agents. 2015; 46:494-501

61.

Simons A, Alhanout K, Duval RE. Bacteriocins, antimicrobial peptides from bacterial origin: overview of their biology and their impact against multidrug-resistant bacteria. Microorganisms. 2020; 8:639

62.

Han SG, Kwon HC, Kim DH, Hong SJ, Han SG. In vitro synergistic antibacterial and anti-inflammatory effects of nisin and lactic acid in yogurt against Helicobacter pylori and human gastric cells. Food Sci Anim Resour. 2023; 43:751-66

63.

Xu Q, Li X, Wang E, He Y, Yin B, Fang D, et al. A cellular model for screening of lactobacilli that can enhance tight junctions. RSC Adv. 2016; 6:111812-21