Journal of Animal Science and Technology
Korean Society of Animal Sciences and Technology
RESEARCH ARTICLE

Effects of MTAP and PMEL gene polymorphisms on plumage color variation in chickens

Jean Pierre Munyaneza1https://orcid.org/0000-0003-2521-3339, Minjun Kim1https://orcid.org/0000-0002-8173-8431, Eunjin Cho2https://orcid.org/0000-0003-4800-1603, Daehyeok Jin3https://orcid.org/0000-0001-5091-4271, Jihye Cha4,*https://orcid.org/0000-0002-9705-2979, Jun Heon Lee1,2,*https://orcid.org/0000-0003-3996-9209
1Department of Animal Science, Chungnam National University, Daejeon 34134, Korea
2Department of Bio-AI Convergence, Chungnam National University, Daejeon 34134, Korea
3Animal Genetic Resources Research Center, National Institute of Animal Science, Rural Development Administration, Hamyang 50000, Korea
4Animal Genome & Bioinformatics, National Institute of Animal Science, Rural Development Administration, Wanju 55365, Korea
*Corresponding author: Jihye Cha, Animal Genome & Bioinformatics, National Institute of Animal Science, Rural Development Administration, Wanju 55365, Korea, Tel: +82-63-238-7305, E-mail: wischa91@korea.kr
*Corresponding author: Jun Heon Lee, Division of Animal and Dairy Science, Chungnam National University, Daejeon 34134, Korea, Tel: +82-42-821-7031, E-mail: junheon@cnu.ac.kr

© Copyright 2025 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Apr 19, 2024; Revised: Jul 17, 2024; Accepted: Jul 26, 2024

Published Online: Sep 30, 2025

Abstract

Plumage color is an important economic trait in chickens and is mainly affected by genetic factors than environmental factors. This study aimed to detect the single-nucleotide polymorphisms (SNPs) in CDKN2A, MTAP, and PMEL genes and explore their influence on plumage color variation in chickens. We used 428 chicken blood samples, consisting of all-black: 62, all-white: 246, and black and white barred: 120 chickens of F2 population produced from crossing the F1 progenies. The F1 population was produced by crossing Yeonsan Ogye and White Leghorn. The SNPs in the CDKN2A, MTAP, and PMEL genes were initially detected by sequencing. PACE Genotyping technology was used for genotyping and results were observed for a synonymous SNP, rs316391660C/T of the MTAP gene, missense SNPs, rs312616138A/G and rs14684281T/C of the PMEL gene. The association test between the genotypes in MTAP (SNP: rs316391660C/T) and PMEL (SNP: rs14684281T/C) genes was performed by Chi-square test while Fisher’s exact test to evaluate association the genotypes of Please italize PMEL gene (SNP: rs312616138A/G) with plumage color variations. The missense SNP, rs1058656732C/T in CDKN2A gene was monomorphic and could not be used for the association test. There was a significant (p < 0.05) association between genotypes of MTAP and PMEL genes with the three plumage color variations: all-black, all-white, and black and white barred. Our results confirm the genotype effects of the PMEL gene on the dominant white plumage color, and suggest that the synonymous SNP (rs316391660C/T) of the MTAP gene could be used as a genetic marker for the breeding of chickens with black-and-white barred plumage.

Keywords: MTAP gene; plumage color; PMEL gene; F2 population

INTRODUCTION

Coloration is a very important phenotypic trait with various functions related to environmental adaptation, such as temperature regulation and protection against sunburn [1–3], as well as mimicry or camouflage [2–4]. There has long been interest in studying the pigments influencing plumage color in birds, coat color in mammals, and skin color in humans [5]. The plumage color in chickens is genetically complex compared to the coat and skin color in mammals and humans, respectively [5,6]. Besides adapting to the environmental conditions, the plumage color in birds is also an economic trait in the poultry industry with producers and consumers preferring birds of a particular color. For example, the producers of broilers prefer white birds for ease of cleaning and a uniform appearance [7] as well as the easy removal of the feathers [8]. From the consumer’s perspective, plumage color is favored for religious reasons or nutritional value [3].

Plumage color in birds has a key role in sexual selection [2,3,6,9–11] and parent–offspring communication [11]. Melanin is the major pigment producing color in birds and other animals, followed by carotenoids [5,8,11]. Plants, bacteria, and fungi can synthesize carotenoids, while birds and other animals must obtain this pigment from their diet [2,5,11,12]. Carotenoids produce orange, red, and yellow colors in the plumage, bill, skin, and iris [11]. Other pigments such as porphyrins and polyenes influence plumage color in birds [5,6]. Melanin mainly consists of eumelanin and pheomelanin pigments, and eumelanin controls black or brown colors, whereas pheomelanin controls red or yellow colors [3,4,11–14]. Melanin pigments also produce other color patterns such as stripes, spots, and bars in chicken feathers [11,15]. Melanin is produced by melanocytes [13,16]. It is accumulated in melanosomes [3,17] and then transported to keratinocytes [5,10] to give a particular color to the bird’s feathers [5]. In addition to determining color, melanin pigments are associated with antioxidant capacity as well as resistance to bacterial degradation [1,6,11,18].

The production of color in birds is a complex process that is mainly influenced by genetic factors such but also environmental factors [6]. The biosynthesis of melanin depends on tyrosinase activity [9,19,20], and both melanin pigments (eumelanin and pheomelanin) are tyrosine derivatives [4,5]. High tyrosinase activity is associated with the synthesis of eumelanin, whereas low activity results in the production of pheomelanin [4,19,21]. Previous studies have reported that the amount, deposition, distribution, and ratio of melanin pigments affect plumage color in birds [4,5,11,14,20]. Many genes control plumage color in chickens [22]. These genes are involved in melanin synthesis, melanosome transport, melanocyte development, and differentiation [14], and mutations in these genes lead to different colors. For example, the diluted coat color also known as albinism in different species is due to the complete cessation of melanin synthesis caused by mutations in the tyrosinase (TYR) gene and other related genes [9, 14, 23].

Previous studies have explored melanin-related genes (e.g., MC1R, TYR, PMEL; MLPH, ASIP, SLC45A2, EDNRB2, CDKN2A, and SOX10) and confirmed their effects on variation in plumage color in chickens [6,24,25]. The premelanosome protein (PMEL) also known as melanocyte protein Pmel 17 (PMEL17) is encoded by the PMEL gene which is mapped on chromosome 33 and plays a key role in the formation of melanosomes [3,26] and the formation of fibrils on which eumelanin is deposited [5,10,26]. This gene affects the shape of melanosomes [11] and is also involved in the production of eumelanin [10]. Indels in the gene are associated with the dominant white, dun, and smoky colors in chicken plumage [13,27]. A missense mutation in PMEL17 gene is associated with a silver coat color in horses [14,28].

Previous studies have explored the sex-linked barring phenotype in chickens and have reported that the cyclin-dependent kinase inhibitor 2A (CDKN2A) gene located on chromosome Z is responsible for barred plumage in chickens [3,13,25,29]. The four mutations in the CDKN2A gene cause a higher expression of CDKN2A, resulting in a reduction of melanoblasts [3,5,25], thus causing a white bar to appear where melanocytes are absent [5,25]. The methylthioadenosine phosphorylase (MTAP) gene is mapped on chromosome Z and acts as an inhibitor of dermal melanin in chickens and as a tumor suppressor in humans, thus inhibiting melanoma cell proliferation [3]. It is also thought to be involved in the barring plumage of chickens [29]. In the chicken genome assembly (GRCg6a), the PMEL gene is accessed by ENSGALG00000035350 whereas CDKN2A and MTAP genes can be accessed by ENSGALG00000034505 and ENSGALG00000008174, respectively.

A previous genome-wide association study (GWAS) of plumage colors have reported three potential candidate genes that could affect the variation in plumage color in chickens, including the CDKN2A, PMEL, and MTAP genes [3]. However, the genotype effect of these genes on the variation in chicken plumage color are not fully understood. Therefore, we investigated single-nucleotide polymorphisms (SNPs) in the CDKN2A, PMEL, and MTAP genes to assess their effects on the variation in plumage color in Yeonsan Ogye-White Leghorn crossbred chicken’s population.

MATERIALS AND METHODS

Ethical statement

The Animal Ethics Committee of Chungnam National University (no. 202103A-CNU-061) approved this study to abide by the standard guidelines for animal care.

Sampling and DNA extraction

This study used a total sample of 428 birds collected from an F2 population between Yeonsan Ogye and White Leghorn with the three plumage color phenotypes: all black, n = 62, all white, n = 246, and black and white barred (barred), n = 120 as shown in Fig. 1. Yeonsan Ogye is a Korean native chicken breed that is completely black from beak to toes [3,8,30] as well as bones and internal organs [3]. For phenotyping, all while the plumage color of Yeonsan Ogye is completely black, the White Leghorn has a completely white plumage color [30]. F2 population was produced by crossing the F1 progenies. The F1 population was produced by crossing Yeonsan Ogye and White Leghorn. Three phenotypes (all-black, all-white, and black and white barred) were selected, the chicken’s photos were taken by the National Institute of Animal Science (NIAS) in 2020 using a digital camera (D80, Nikon, Tokyo, Japan) as described in [3].

jast-67-5-989-g1
Fig. 1. Yeonsan Ogye-White Leghorn crossbred chickens. (A) all-black, (B) black-and-white barred, (C) all-white. Photos taken by the National Institute of Animal Science in 2020 using a digital camera (D80, Nikon, Tokyo, Japan).
Download Original Figure

The chickens used in this study were kept under the same management conditions at the Animal Genetic Resources Research Center’s farm at the NIAS, Korea. Genomic DNA was extracted from blood samples of birds at 8 weeks of age using the Wizard Genomic DNA Purification Kit (Promega). DNA stocks were diluted with deionized distilled water to produce a working concentration of 25 ng/μL and stored at −20°C.

Polymerase chain reaction amplification

Two pairs of primers were designed to amplify the fragment of 440 bp and 293 bp for missense variant: rs14684281T/C and missense variant: rs312616138A/G in the PMEL gene, respectively. A fragment of 351 bp and a fragment of 623 bp were also amplified to identify the SNPs: synonymous variant: rs316391660C/T and a missense variant: rs1058656732C/T in the MTAP and CDKN2A genes, respectively. We designed these primers by primer-BLAST tool and were synthesized by Bioneer. The primers used in this study are presented in Table 1. We performed the PCR amplification using the same conditions as described in our previous work [31]. Annealing temperatures for each primer set are presented in Table 1.

Table 1. Primer design information and PCR amplification conditions for sequencing of the PMEL, MTAP, and CDKN2A genes
Gene SNP Primer F/R Amplicon size (bp) Annealing temperature (°C)
CDKN2A rs1058656732C/T
Missense
F:5’- GCTGCGCTCTTCTGCTTTGA-3’
R:5’- TGAATGGAGAGTGAGAGAGC-3’
623 66
PMEL rs14684281T/C
Missense
F: 5′-CTGAGCGTCACATGAAAGAG-3′
R: 5′-GAAGCGCAGAGCGATGGAGA-3′
440 65
rs312616138A/G
Missense
F:5’-CTCAGTGGCTGTGCTATCAG-3’
R:5’-AAAGAAGCAGCTGGGAATAG-3’
293 65
MTAP rs316391660C/T
Synonymous
F:5’-GGTTCATCTGTAGCCTGCAA-3’
R:5’-AGCAGCCCACTCTTCCTGCT-3’
351 66

PCR, polymerase chain reaction; bp, base pair; F, forward; R, reverse.

Download Excel Table
Sequencing of CDKN2A, MTAP, and PMEL genes

Before sequencing, the PrimePrep PCR Purification Kit (GenetBio) was used to purify the PCR products, and spectrophotometry (NanoDrop 2000, Thermo Fisher Scientific) was used to check the quality of DNA. Sequencing was performed by Bioneer . One missense variant was confirmed in the CDKN2A gene (rs1058656732C/T), and in the MTAP gene, one synonymous variant was identified (rs316391660C/T) whereas two missense variants were found in the PMEL gene (rs14684281T/C and rs312616138A/G) (Fig. 2).

jast-67-5-989-g2
Fig. 2. SNP detection results in the target genes. (A) rs14684281T/C/missense in the PMEL gene, (B) rs312616138A/G/missense in the PMEL gene, (C) rs316391660C/T/synonymous in the MTAP gene, (D) rs1058656732C/T/missense SNP in CDKN2A of Yeonsan Ogye-White Leghorn crossbred chickens.
Download Original Figure
Genotyping of MTAP and PMEL genes

The PCR allelic competitive extension (PACE) technology was used for genotyping our targeted SNPs. We prepared the SNP target-specific primers for the PACE genotyping assay (Table 2). The PACE assay mix and PACE master mix are shown in Table 2. The PACE assay mix and PACE master mix were synthesized by 3CR Bioscience. A 96-well plate was used for genotyping, and each well had 10 μL made up of 1 μL of genomic DNA (5 ng/μL) or 1 μL of 3DW for negative control, 5 μL of master mix, 0.25 μL of assay mix, and 3.75 μL of 3DW. We run the reaction by using the CFX ConnectTM Real-time PCR Detection System (Bio-Rad Laboratories).

Table 2. Primer design information and PCR amplification conditions for PACE genotyping of the PMEL, MTAP, and CDKN2A genes
Gene SNP Primers Annealing temperature (°C)
CDKN2A rs1058656732
C/T
Missense
Forward primer X, Y (5’-3’)
GAAGGTGACCAAGTTCATGCTCCGCAGGACAGCGGCCAC/
GAAGGTCGGAGTCAACGGATTCCGCAGGACAGCGGCCAT

Common primer
CTCGCTGCTCCGGCGCATCTT
C/T (FAM/HEX)
55
PMEL rs14684281
T/C
Missense
Forward primer X, Y (5’-3’)
GAAGGTGACCAAGTTCATGCTGGTGGCGTTAAGGGCTCGGT/
GAAGGTCGGAGTCAACGGATTGTGGCGTTAAGGGCTCGGC

Common primer
CGCTGTATCCCAGCTCCGGAA
T/C (FAM/HEX)
55
rs312616138
A/G
Missense
Forward primer X, Y (5’-3’)
GAAGGTGACCAAGTTCATGCTCAGCACCGCAGTGGCCA/
GAAGGTCGGAGTCAACGGATTCAGCACCGCAGTGGCCG

Common primer
GGTCTGTACCGGCTGCTGCAT
A/G (FAM/HEX)
55
MTAP rs316391660
C/T
Synonymous
Forward primer X, Y (5’-3’)
GAAGGTGACCAAGTTCATGCTCATTTCAGACAACTGTGCAGTGC/
GAAGGTCGGAGTCAACGGATTGCATTTCAGACAACTGTGCAGTGT

Common primer
AGGCAGCTACTGCTTTGGCAGAAT
A/G (FAM/HEX)
55

PCR, polymerase chain reaction; PACE, PCR allelic competitive extension.

Download Excel Table
Association analysis

Association analysis between the genotypes of MTAP gene (rs316391660C/T) and PMEL gene (rs312616138A/G and rs14684281T/C) with plumage color variations in Yeonsan-Ogye-White leghorn crossbred chickens was performed by Fisher’s exact test. Fisher’s exact test is appropriate for small sample size or if some expected frequencies are less than 5. All calculations were carried out by using the R program [32]. A significant association was confirmed when p < 0.05.

RESULTS

Detection of SNPs by sequencing

Sequencing the target genes was performed to detect different variants in the F2 population. Two missense variants were detected in PMEL (rs14684281T/C, rs312616138A/G); one synonymous mutation was detected in MTAP (rs316391660C/T), and one missense mutation was detected in CDKN2A (rs1058656732C/T) as shown in Fig. 2. A missense SNP: rs14684281T/C of the PMEL gene is located in exon 2 whereas a missense SNP: rs312616138A/G is located in exon 6 of the PMEL gene mapped on chromosome 33. Moreover, a missense SNP: rs1058656732C/T of the CDKN2A gene is found in exon 1 whereas a synonymous SNP: rs316391660C/T is found in exon 6 of the MTAP gene. Both CDKN2A and MTAP gene are mapped on Z chromosome. All variants detected by sequencing in the CDKN2A, PMEL, and MTAP genes were genotyped by the PACE genotyping method.

Genotyping of the CDKN2A, MTAP, and PMEL genes

PACE genotyping result of the CDKN2A, MTAP, and PMEL genes showed that the rs1058656732C/T variant in CDKN2A gene has one CC genotype in all F2 population, which means that the variant is monomorphic in the F2 population. Two missense variants (rs312616138A/G; rs14684281T/C) in the PMEL gene resulted in three genotypes each (AA, AG, and GG; CC, CT, and TT, respectively; Fig. 3), and a synonymous SNP (rs316391660C/T) in the MTAP gene resulted in three genotypes: CC, CT, and TT (Fig. 3).

jast-67-5-989-g3
Fig. 3. Genotype results with PACE genotyping in Yeonsan-Ogye-White Leghorn crossbred chickens. (A) rs14684281T/C/missense in the PMEL gene, (B) rs312616138A/G/missense in the PMEL gene, (C) rs316391660C/T/synonymous in the MTAP gene. NEG, negative control.
Download Original Figure
Genotype and allele frequencies

Regarding the synonymous SNP (rs316391660C/T) of the MTAP gene, the TT genotype had the highest frequency (52.1%), followed by the CT (24.4%) and CC genotypes (23.5%) in a total population of 428 chickens, consisting of all-black (62), all-white (246), and black-and-white barred (120) chickens (Table 3). Regarding one missense SNP of PMEL (rs312616138A/G), the homozygous AA genotype had the highest frequency (50.2%), followed by the GG genotype (46.5%) and heterozygous AG genotype (3.3%) (Table 3). Regarding the other missense SNP (rs14684281T/C), the homozygous genotype CC had the highest frequency (58.9%), followed by the homozygous TT genotype (26.2%), and the heterozygous CT genotype had the lowest frequency (14.9%) (Table 3). The genotype and allele frequencies in each class of plumage color are shown in Table 3.

Table 3. Effects of the MTAP and PMEL genotypes on plumage color phenotypes in Yeonsan Ogye-White Leghorn crossbred chickens
Gene SNP Genotype/allele Genotype/allele count (frequency in total population, %) Total genotype/allele frequency (%) Fisher's exact test
Plumage color
All-black Black and white barred All-white
MTAP rs316391660
C/T (synonymous)
Males
CC 24 (10) 3 (1.2) 0 (0.0) 11.2 p < 2e-16**
CT 0(0.0) 42 (17.4) 57 (23.6) 41.0
TT 0(0.0) 26 (10.8) 89 (37.0) 47.8
C 48 (10.0) 48 (10.0) 57 (11.8) 31.8
T 0 (0.0) 94 (19.5) 235 (48.7) 68.2
Total for males 24 71 146
Females
CC 38 (20.3) 1 (0.5) 35 (18.8) 39.6 p < 2e-16**
CT 0 (0) 1 (0.5) 4 (2.1) 2.6
TT 0 (0) 47 (25.1) 61 (32.7) 57.8
C 76 (20.3) 3 (0.8) 74 (19.8) 40.9
T 0 (0.0) 95 (25.4) 126 (33.7) 59.1
Total for females 38 49 100
Total across sex 62 120 246
PMEL rs312616138
A/G(missense)
Males
AA 21 (8.3) 47 (18.6) 60 (23.8) 50.7 p = 2e-07**
AG 1 (0.4) 6 (2.4) 1 (0.4) 3.2
GG 3 (1.2) 25 (10.0) 88 (34.9) 46.1
A 43 (8.6) 100 (19.8) 121 (24.0) 52.4
G 7 (1.4) 56 (11.1) 177 (35.1) 47.6
Total for males 25 78 149
Females
AA 26 (14.8) 37 (21.0) 24 (13.6) 49.4 p = 4e-14**
AG 1 (0.6) 2 (1.1) 3 (1.7) 3.4
GG 10 (5.7) 3 (1.7) 70 (39.8) 47.2
A 53 (15.1) 76 (21.6) 51 (14.5) 51.2
G 21 (5.9) 8 (2.3) 143 (40.6) 48.8
Total for females 37 42 97
Total across sex 62 120 246
MTAP rs14684281
T/C (missense)
Males
TT 27 (11.0) 42 (17.0) 0(0) 28.0 p < 2e-16**
CT 1 (0.4) 6 (2.4) 37 (15.1) 17.9
CC 1 (0.4) 25 (10.2) 107 (43.5) 54.1
T 55 (11.2) 90 (18.3) 37 (7.5) 37
C 3 (0.6) 56 (11.4) 251 (51.0) 63
Total for males 29 73 144
Females
TT 17 (9.3) 26 (14.3) 1 (0.5) 24.1 p < 2e-16**
CT 1 (0.5) 2 (1.1) 17 (9.4) 11.0
CC 15 (8.2) 19 (10.5) 84 (46.2) 64.9
T 35 (9.6) 54 (14.9) 19 (5.2) 29.7
C 31 (8.5) 40 (11.0) 185 (50.8) 70.3
Total for females 33 47 102
Total across sex 62 120 246

Strong significant (p < 0.001).

Download Excel Table
Association test between the MTAP and PMEL genotypes with variation in plumage color

To evaluate the MTAP and PMEL genotype effects on the variation in plumage color, we performed the chi-square and Fisher’s exact tests. The MTAP (rs316391660C/T) and PMEL genotypes (rs312616138A/G and rs14684281T/C) had a significant (p < 0.05) influence on the three plumage color variants (Table 3). For rs316391660C/T variant of the MTAP gene, the frequency of the homozygous CC genotype in all-black chickens was higher than in white and black-and-white barred chickens, whereas the frequency of the homozygous TT genotype was higher in all-white chickens than in all-black and black-and-white barred chickens. For the rs312616138A/G missense SNP of PMEL, the homozygous AA genotype had a greater frequency in all-white and black-and-white barred chickens compared to that in all-black chickens, while the frequency of the GG genotype was higher in all-white chickens. For the rs14684281T/C missense SNP of the PMEL gene, the frequency of the TT homozygous genotype was higher in black-and-white barred chickens than in all-black and all-white chickens, whereas the homozygous CC genotype had the highest frequency in all-white chickens compared to all-black and black and white chickens. Due to sexual dimorphism for plumage color traits, association test between the genotypes and plumage color variations was performed separately in males and females, and results are shown in Table 3.

DISCUSSION

We explored one variant (rs316391660C/T) in the MTAP gene, one (rs1058656732C/T) in the CDKN2A gene, and two (rs312616138A/G; rs14684281T/C) in the PMEL gene to confirm their genotype effects on the coloration of chicken plumage which is influenced by many genes [22]. These genes have been reported to be involved in the synthesis of melanin, melanosome transport, melanocyte development, as well as their differentiation [14]. In previous study, it has been reported that the PMEL gene is associated with the dominant white, dun, and smoky colors in chicken plumage [27]. The insertion of 9 bp in exon 10 of PMEL gene inhibits the synthesis of eumelanin in feathers [3,27]. Another candidate gene MTAP causes the barring plumage of chickens [29]. The white bar that appears in black-and-white barred plumage is formed due to the absence of melanocytes [25]. In this study, we explored the influence of these two genes and their effects on three plumage colors: all-black, all-white, and black-and-white barred chickens. We report a significant influence of both of these genes. This study found two missense variants in the PMEL gene. A SNP: rs14684281T/C found in exon 2 lead to a change of amino acid from valine (V) to alanine (A) at the 35th position of the protein whereas a SNP: rs312616138A/G in exon 6 and lead to a change of amino acid from asparagine (N) to aspartic acid (D) at the 399th position of protein. Furthermore, we checked the sorting intolerant from tolerant (SIFT) scores for two SNPs (rs14684281T/C and rs312616138A/G) in PMEL gene and were likely to be tolerated (0.95 and 0.71, respectively) which means the change of amino acid does not significantly affect the protein function. The change for amino acid at the beginning of the protein for the SNP: rs14684281T/C (V35A in exon) and that of SNP: rs312616138A/G (N399D) might affect the protein folding or protein stability thus affecting the formation of melanosome.

To the best of our knowledge, this is the first study to report the association between the MTAP genotypes and the plumage coloration in chickens. For rs316391660C/T variant in the MTAP gene, the heterozygous CT and homozygous TT genotypes were absent in all-black chicken population (Table 3). The homozygous CC genotype was more frequent in all-black chickens and the allele C was fixed (100%) in all-black chickens (Table 3). This fixation was probably due to the artificial selection [33]. In this study, we used F2 population between Yeonsan Ogye and White Leghorn. The F0 population was sampled from a small population of Yeonsan Ogye, which may contribute to the fixation of the C allele in rs316391660 C/T (synonymous) locus of the MTAP gene in the all-black chickens. For rs14684281T/C variant in the PMEL gene, the homozygous CC genotype was more frequent than the CT and TT genotypes in all-white chicken population. All three genotypes (CC, CT, and TT) were significantly associated with all three plumage colors: all-black, all-white, and black-and-white barred chickens.

The plumage color bas been known to be a complex trait influenced by several genes. We discovered that one synonymous SNP (rs316391660C/T) in the MTAP and two missense SNPs (rs312616138A/G and rs14684281T/C) in the PMEL genes have a significant genotype effect on the three plumage colorations. These results confirm the genotype effects of the PMEL gene on the dominant white plumage color, and suggest that the MTAP gene could be used as a genetic marker for the breeding of chickens with black-and-white barred plumage. However, further studies exploring the biological functions of the MTAP gene and identifying different variants using large-scale sample sizes are needed.

CONCLUSION

In this study, we detected the SNPs in the CDKN2A, PMEL, and MTAP genes and assess their genotype effects on the variation in plumage color in chickens. Our results showed that the synonymous SNP (rs316391660C/T) in the MTAP gene and two missense SNPs (rs312616138A/G; rs14684281T/C) in the PMEL gene were found to have a significant genotype effect on plumage color in Yeonsan Ogye-White Leghorn crossbred chicken population. Our findings could help to elucidate the genetic mechanisms underlying chicken plumage coloration. Furthermore, the synonymous SNP (rs316391660C/T) in the MTAP gene can be used as a genetic marker for breeding chickens with black-and-white barred plumage.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

Not applicable.

Acknowledgements

Not applicable.

Availability of data and material

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Authors’ contributions

Conceptualization: Lee JH.

Data curation: Munyaneza JP, Kim M, Cho E.

Formal analysis: Munyaneza JP, Kim M, Cho E.

Methodology: Munyaneza JP, Kim M, Cho E.

Software: Munyaneza JP, Kim M, Cho E.

Validation: Jin D, Cha J, Lee JH.

Investigation: Munyaneza JP, Kim M, Cho E.

Writing – original draft: Munyaneza JP.

Writing - review & editing: Munyaneza JP, Kim M, Cho E, Jin D, Cha J, Lee JH.

Ethics approval and consent to participate

The Animal Ethics Committee of Chungnam National University (no. 202103A-CNU-061) approved this study to abide by the standard guidelines for animal care.

REFERENCES

1.

Orteu A, Jiggins CD. The genomics of coloration provides insights into adaptive evolution. Nat Rev Genet. 2020; 21:461-75

2.

Wu J, Lin Z, Chen G, Luo Q, Nie Q, Zhang X, et al. Characterization of chicken skin yellowness and exploration of genes involved in skin yellowness deposition in chicken. Front Physiol. 2021; 12:585089

3.

Heo S, Cho S, Dinh PTN, Park J, Jin DH, Cha J, et al. A genome-wide association study for eumelanin pigmentation in chicken plumage using a computer vision approach. Anim Genet. 2023; 54:355-62

4.

Zhang X, Zhu T, Wang L, Lv X, Yang W, Qu C, et al. Genome-wide association study reveals the genetic basis of duck plumage colors. Genes. 2023; 14:856

5.

Zheng X, Zhang B, Zhang Y, Zhong H, Nie R, Li J, et al. Transcriptome analysis of feather follicles reveals candidate genes and pathways associated with pheomelanin pigmentation in chickens. Sci Rep. 2020; 10:12088

6.

Davoodi P, Ehsani A, Vaez Torshizi R, Masoudi AA. New insights into genetics underlying of plumage color. Anim Genet. 2022; 53:80-93

7.

Li S, Wang C, Yu W, Zhao S, Gong Y. Identification of genes related to white and black plumage formation by RNA-Seq from white and black feather bulbs in ducks. PLOS ONE. 2012; 7e36592

8.

Cho E, Kim M, Manjula P, Cho SH, Seo D, Lee SS, et al. A retroviral insertion in the tyrosinase (TYR) gene is associated with the recessive white plumage color in the Yeonsan Ogye chicken. J Anim Sci Technol. 2021; 63:751-8

9.

Liu WB, Chen SR, Zheng JX, Qu LJ, Xu GY, Yang N. Developmental phenotypic-genotypic associations of tyrosinase and melanocortin 1 receptor genes with changing profiles in chicken plumage pigmentation. Poult Sci. 2010; 89:1110-4

10.

Ishishita S, Takahashi M, Yamaguchi K, Kinoshita K, Nakano M, Nunome M, et al. Nonsense mutation in PMEL is associated with yellowish plumage colour phenotype in Japanese quail. Sci Rep. 2018; 8:16732

11.

Price-Waldman R, Stoddard MC. Avian coloration genetics: recent advances and emerging questions. J Hered. 2021; 112:395-416

12.

Walsh N, Dale J, McGraw KJ, Pointer MA, Mundy NI. Candidate genes for carotenoid coloration in vertebrates and their expression profiles in the carotenoid-containing plumage and bill of a wild bird. Proc R Soc B Biol Sci. 2012; 279:58-66

13.

Hua G, Chen J, Wang J, Li J, Deng X. Genetic basis of chicken plumage color in artificial population of complex epistasis. Anim Genet. 2021; 52:656-66

14.

Kimura S, Hatakeyama T, Koutaka T, Kubo K, Morita S, Eguchi K, et al. PMEL p.Leu18del dilutes coat color of Kumamoto sub-breed of Japanese Brown cattle. BMC Genomics. 2022; 23:694

15.

Inaba M, Chuong CM. Avian pigment pattern formation: developmental control of macro- (across the body) and micro- (within a feather) level of pigment patterns. Front Cell Dev Biol. 2020; 8:620

16.

Hearing VJ. Determination of melanin synthetic pathways. J Invest Dermatol. 2011; 131:E8-11

17.

Hirobe T. Keratinocytes regulate the function of melanocytes. Dermatol Sin. 2014; 32:200-4

18.

McNamara ME, Rossi V, Slater TS, Rogers CS, Ducrest AL, Dubey S, et al. Decoding the evolution of melanin in vertebrates. Trends Ecol Evol. 2021; 36:430-43

19.

Gunnarsson U, Hellström AR, Tixier-Boichard M, Minvielle F, Bed’hom B, Ito S, et al. Mutations in SLC45A2 cause plumage color variation in chicken and Japanese quail. Genetics. 2007; 175:867-77

20.

Yang C, Ran J, Yu C, Qiu M, Zhang Z, Du H, et al. Polymorphism in MC1R, TYR and ASIP genes in different colored feather chickens. 3 Biotech. 2019; 9:203

21.

Huang J, Zhou B, He DQ, Chen SY, Zhu Q, Yao YG, et al. Sequence variation of melanocortin 1 receptor (MC1R) gene and association with plumage color in domestic geese. J Poult Sci. 2014; 51:270-4

22.

Dávila SG, Gil MG, Resino-Talaván P, Campo JL. Association between polymorphism in the melanocortin 1 receptor gene and E locus plumage color phenotype. Poult Sci. 2014; 93:1089-96

23.

Makarova AV, Mitrofanova OV, Vakhrameev AB, Dementeva NV. Molecular-genetic bases of plumage coloring in chicken. Vavilov J Genet Breed. 2019; 23:343-54

24.

Gunnarsson U, Kerje S, Bed’hom B, Sahlqvist AS, Ekwall O, Tixier-Boichard M, et al. The Dark brown plumage color in chickens is caused by an 8.3-kb deletion upstream of SOX10. Pigment Cell Melanoma Res. 2011; 24:268-74

25.

Schwochow Thalmann D, Ring H, Sundström E, Cao X, Larsson M, Kerje S, et al. The evolution of Sex-linked barring alleles in chickens involves both regulatory and coding changes in CDKN2A. PLoS Genet. 2017; 13e1006665

26.

Fontanesi L, Scotti E, Colombo M, Allain D, Deretz S, Dall’olio S, et al. Investigation of the premelanosome protein (PMEL or SILV) gene and identification of polymorphism excluding it as the determinant of the dilute locus in domestic rabbits (Oryctolagus cuniculus). Arch Tierz. 2013; 56:42-9

27.

Kerje S, Sharma P, Gunnarsson U, Kim H, Bagchi S, Fredriksson R, et al. The Dominant white, Dun and Smoky color variants in chicken are associated with insertion/deletion polymorphisms in the PMEL17 gene. Genetics. 2004; 168:1507-18

28.

Brunberg E, Andersson L, Cothran G, Sandberg K, Mikko S, Lindgren G. A missense mutation in PMEL17 is associated with the Silver coat color in the horse. BMC Genet. 2006; 7:46

29.

Dorshorst BJ, Ashwell CM. Genetic mapping of the sex-linked barring gene in the chicken. Poult Sci. 2009; 88:1811-7

30.

Cho Y, Kim JY, Kim N. Comparative genomics and selection analysis of Yeonsan Ogye black chicken with whole-genome sequencing. Genomics. 2022; 114:110298

31.

Munyaneza JP, Kim M, Cho E, Jang A, Choo HJ, Lee JH. Association of single-nucleotide polymorphisms in dual specificity phosphatase 8 and insulin-like growth factor 2 genes with inosine-5′-monophosphate, inosine, and hypoxanthine contents in chickens. Anim Biosci. 2023; 36:1357-66

32.

R Core Team. R: a language and environment for statistical computing. Vienna: R Foundation for Statistical Computing. 2022

33.

Allendorf FW, Luikart G, Aitken SN. Conservation and the genetics of populations. 2nd ed Chichester: Wiley Blackwell. 2013; p p. 118-32