Journal of Animal Science and Technology
Korean Society of Animal Sciences and Technology
RESEARCH ARTICLE

Effects of polyphosphates with different chain lengths on digestive organ weight, carcass quality, and immune response, and intestinal microflora in broilers

Yi-Qiang Chang1https://orcid.org/0000-0001-9732-1705, Seung-Gyu Moon1https://orcid.org/0000-0003-4953-4102, Yan-Qing Wang1https://orcid.org/0009-0006-5848-031X, Sang-Woo Jeon1https://orcid.org/0000-0002-1414-8175, Ah-Ran Lee2https://orcid.org/0000-0001-7163-0059, Soo-Hyun Kim3https://orcid.org/0000-0002-8277-7424, Won-Uk Hwang4https://orcid.org/0000-0002-7793-1650, Soo-Ki Kim1,*https://orcid.org/0000-0003-3499-3330
1Department of Animal Science and Technology, Konkuk University, Seoul 05029, Korea
2Animal Resources Research Center, Konkuk University, Seoul 05029, Korea
3Laboratory of Cytokine Immunology, College of Veterinary Medicine, Konkuk University, Seoul 05029, Korea
4Department of Companion Animal and Department of Animal Health, Seojeong University, Yangju, Korea
*Corresponding author: Soo-Ki Kim, Department of Animal Science and Technology, Konkuk University, Seoul 05029, Korea, Tel: +82-2-450-3728, E-mail: sookikim@konkuk.ac.kr

© Copyright 2025 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Apr 10, 2024; Revised: May 25, 2024; Accepted: May 28, 2024

Published Online: Jul 31, 2025

Abstract

Physiological effects of polyphosphates with different chain lengths were unknown in poultry. The effect of 0.05% concentration of short chain polyphosphates (SCPP), medium chain polyphosphates (MCPP) and long chain polyphosphates (LCPP) was observed in broilers. MCPP and LCPP produced bacteriostatic properties against four pathogenic bacteria, Shigella sonnei, Pseudomonas aeruginosa, Salmonella enterica serovar. Pullorum, and Escherichia coli O157:H7. SCPP reduced the level of triglycerides in the blood. Intervention of MCPP and LCPP induced cecum IL-1β expression involved in the regulation of autoimmune inflammation. In terms of colony-forming units, SCPP increased the number of Lactobacilli while MCPP and LCPP significantly decreasing the number of Shigella, Salmonella and Coliform bacteria. SCPP, MCPP, and LCPP improved the intestinal microflora with abundance of beneficial bacteria such as Faecalibacterium, Phocaeicola, and Barnesiella but with reduced Bacteroides. In addition, SCPP, MCPP, and LCPP did not adversely affect the meat quality of broilers. The antimicrobial properties of SCPP, MCPP, and LCPP can help to improve the intestinal environment and enhance immune properties. Based on the comparison of different length polyphosphates in broiler chickens, it is suggested that MCPP is more effective compared to SCPP and LCPP as antimicrobial feed additives.

Keywords: Polyphosphates; Antimicrobial activity; Anti-inflammation; Broilers; Microbiota

INTRODUCTION

The kind of linear polymer known as polyphosphates (Poly-p) is composed of tens or hundreds of orthophosphate (Pi) residues joined by high-energy phosphonic anhydride bonds. Poly-p are commonly found in cells. Since it was impossible to precisely measure or analyze the concentration of Poly-p in biological sources, their physiological roles were frequently disregarded in the past. Nowadays, it has been found that Poly-p possess diverse biological functions [1]. They are chelating agents for metal ions, buffers against alkalis, and capsules for bacteria. They play important roles in the processing and degradation of mRNA and environmental remediation of sodium phosphate depending on the requirement and location (species, cell, or subcellular compartment) [1,2]. Poly-p have significant prohemostatic, pro-thrombotic, and pro-inflammatory effects, and long chain Poly-p (LCPP) are potent pro coagulant physiological activators and can act as modulators of coagulation and inflammation [3]. Poly-p are widely known for their role in biomedicine [4]. Poly-p released by platelets or microorganisms will aid the expression of coagulation and fibrinolytic factors during wound healing [5]. In addition, Poly-p promote regeneration and repair of bone tissue [6].

The biological chain length of Poly-p is variable and can be higher than 1,000 n or lower than 100 n. The chemical effect of Poly-p with different chain lengths varies depending on the organism and the concentration of Poly-p used. in general, the higher the value of the Poly-p polymer, the greater the inhibition of the growth of undesirable microorganisms [7]. There is scientific evidence showing that LCPP can be cut into multiple short chain Poly-p (SCPP) [8]. In heart therapy, two Poly-p with different chain lengths expressed differential effects [9]. It has been found that medium and LCPP, consisting of an average of 60 phosphate residues, enhance cell proliferative activity in vitro, whereas SCPP, consisting of an average of 14 residues, have no such activity. Medium chain Poly-p (MCPP) influenced the creation and regeneration of bone, whereas LCPP had a strong inhibitory effect on bone resorption. SCPP had little effect [10].

Poly-p have been used in animal feeding. Addition of Poly-p to dairy cow diets improves milk production efficiency [11]. Poly-p could improve the antioxidant properties of the organism as well as the pH value of livestock products [12,13]. The addition of urea or ammonium Poly-p to rations fed to pigs can increase serum urea nitrogen levels and ammonium Poly-p has been used as a source of phosphorus [14]. Previous experimental results have demonstrated several benefits of Poly-p for broilers. Moon et al. [15] found that LCPP enhance the immune status based on broiler growth, which includes improved growth performance, organ development, blood and intestinal microflora constitution.

In previous experiments, the focus was only on the study of LCPP or SCPP, while comparisons of antimicrobial properties among short, medium, and long chains were rare. Therefore, we conducted comparative analyses of in vitro antimicrobial properties, organ development, meat quality, serum, anti-inflammatory and gut flora properties using SCPP, MCPP, and LCPP.

MATERIALS AND METHODS

Preparation of experimental additives

RegeneTiss (Kunitachi, Japan) provided sodium Poly-p (Nan+2PnO3n+1) with an average chain length of P3 (SCPP), P14 (MCPP) and P130 (LCPP) for the experiment.

Experimental animals and design

Forty 1-day-old Ross 308 male chicks were randomly divided into four groups of 10 chicks each and 10 chickens were placed in a pen (1.8 m long, 1.5 m wide, 1.3 m high): NC group (basal diet); P3 group (basal diet + 0.05% short Poly-p); P14 group (basal diet + 0.05% medium Poly-p); P130 group (basal diet + 0.05% long Poly-p). The basal diet was formulated according to the Niu et al. [16]. SCPP, MCPP and LCPP were dissolved in water (1 L) at 0.05% of the diet and premixed with a small amount (2 kg) of the basal diet. Afterwards, the premixed feed is mixed with the total feed for 30 minutes using a feed mixer to achieve a thorough mix (DKM-350SU, DAE KWANG, Hwaseong, Korea). The experimental period was divided into two phases, including a starter phase and a grower phase by basal diet formulations (Table 1). The feeding floor was covered with bran at a thickness of 5 cm. Feed and water were supplied throughout the entire trial, providing 23 hours of light and one hour of darkness. The temperature was set at 33°C for the first week and then lowered by two degrees per week until the end of the 22°C feeding period. At the end of the experiment, three broilers were randomly selected from each group, processed using animal ethics committee standards and samples were collected.

Table 1. Nutritional compositions of the basal diet
Items Starter (1 to 21 day) Grower (21 to 35 day)
Ingredient (%)
 Corn 50.75 53.511
 Wheat 5.00 5.00
 SBM (IMP) 34.09 31.331
 Tallow 4.99 6.117
 L-Methionine (98%) 0.32 0.247
 Lysine-Syn 24% 0.96 0.244
 L-Threonine (98%) 0.13 0.027
 Limestone 1.59 1.535
 MDCP 1.29 1.156
 Choline Cl (50%) 0.10 0.071
 Salt 0.28 0.28
 Vitamin premix1) 0.15 0.15
 Mineral premix2) 0.15 0.15
 Phytase 0.02 0.02
 NaHCO3 0.16 0.16
Chemical composition calculated
 CP (%) 21.00 19.00
 Crude fiber (%) 2.88 2.96
 Ca (%) 0.90 0.85
 Available phosphorus (%) 0.35 0.32
 Total Lys (%) 1.37 1.10
 Total TSAA (%) 0.99 0.87
 Total Thr (%) 0.90 0.74
 AMEn (kcal/kg) 3,050 3,146

Per kilogram of diet, mineral premix contained the following: 80 mg Fe; 50 mg Zn; 60 mg Mn; 0.3 mg Co; 10 mg Cu; 0.2 mg Se.

Per kilogram of diet, vitamin premix ingredients were as follows: vitamin A, 80,000 IU; vitamin D3,1600 IU; vitamin E, 20 IU; vitamin K3, 8 mg; vitamin B1, 8 mg; vitamin B2, 24 mg; vitamin B6, 12 mg; vitamin B12, 0.040 mg; pantothenic acid, 40 mg; folic acid, 4 mg; nicotinic acid, 120 mg.

SBM, soybean meal; IMP, inosine monophosphate; MDCP, Monodicalcium phosphate; CP, crude protein; Lys, lysine; TSAA, total sulfur amino acids; Thr, threonine.

Download Excel Table
Antibacterial activity of Poly-p

Escherichia coli O157:H7 ATCC 35150, Listeria monocytogenes KCCM 40307, Salmonella entericaser. Gallinarum ATCC 9184, Salmonella entericas er. Pullorum SP4, Pseudomonas aeruginosa PA01, and Shigella sonnei KCTC 2518 were provided by Korea Research Institute of Bioscience and Biotechnology (Daejeon, Korea). Klebsiella pneumoniae was from our laboratory stock. Escherichia coli O157:H7, S. enterica ser. Gallinarum, S. enterica ser. Pullorum SP4, K. pneumoniae, and S. sonnei were grown in Luria-Bertani (LB; Difco, Franklin Lakes, NJ, USA) broth. L. monocytogenes and P. aeruginosa were grown in brain heart infusion (BHI, Difco) broth and nutrient broth (Difco), respectively. At 37°C with shaking (100 rpm), cultures were cultivated aerobically for 16 hours. LCPP, MCPP, and SCPP were dissolved in sterile distilled water to achieve a concentration of 50 mg/ml. Disinfect the solution by filtration by adjusting the pH to 7.0. Using sterilized cotton swabs, all freshly created bacterial cultures (~1×108–9 CFU/mL) were swabbed onto corresponding agar plates. Aliquots (100 µL) of SCPP, MCPP, and LCPP at three same concentrations were then added into wells (6 mm in diameter) of agar plates. It was then incubated at 37°C for 16 hours, after which the zone of inhibition was observed, measured with a straightedge and recorded.

Organ

Breast meat, right leg, liver, spleen, bursa, small intestine (duodenum, jejunum and ileum) and cecum were collected from broilers. The weights were weighed using an electronic balance (EL4002, Mettler Toledo, Columbus, OH, USA). The length of the small intestine and cecum was subsequently measured and recorded using a tape measure. Units are expressed as a rate per 100 grams of live weight.

Meat quality

The measuring needle of the pH meter (Hanna Instruments, Nusfalau, Romania) was inserted 1 cm into the chicken breast, the value was read and three measurements were averaged. Cooking loss was calculated by heating samples in polyethylene bags in a water bath (C-WBE, Chang Shin, Seoul, Korea) at 75°C for 30 minutes. Chicken breasts were cooled for 10 minutes. The difference in weight of the chicken breasts before and after steaming was used to calculate the cooking loss using the following formula:

* Cooking loss ( % ) = ( Sample weight before cooking − Sample weight after cooking ) / ( Sample   weight before cooking ) × 100

Flesh colour was measured on the surface of the samples using a colourimeter (Chromameter, CR210, Minolta, Osaka, Japan) with L* values for brightness, a* values for redness and b* values for yellowness. The standard colour used was a calibration plate with an L* value of 97.69, an a* value of −0.43, and a b* value of +1.98.

Serum

The chemical compositions of the blood samples taken from broilers in this experiment were analysed using an automated dry chemical analyser for veterinary use (CHEM7000i, Fujifilm, Tokyo, Japan) at the Biological Center of Konkuk University Research Facility (Seoul, Korea).

Anti-inflammation

Each cytokine and beta actin gene accession number were obtained from NCBI reference sequence. MMLV-RT (Beams Bio, Seongnam, Korea) was used for converting 2 μg of total RNA to first strand cDNA and then polymerase chain reaction (PCR) was performed at 94°C for 45 sec, 70°C for 2 min, and 55°C for 1 min for 30 cycles. The expected size of PCR product was indicated by arrow.

Expression levels of four different avian pro- or anti-inflammatory cytokine genes, interleukin-1β (IL-1β), IL-1 receptor antagonist (IL-1RN), IL-6, and tumor necrosis factor (TNF-α), in three intestinal organs (jejunum, ileum, and cecum) after feeding three different polymers (SCPP, MCPP, and LCPP) were examined with Reverse transcription (RT)-PCR. RT-PCR was performed with an annealing temperature of 55°C and 30 cycles of amplificatnion using an EmeraldAmp PCR Master Mix (Takara, Shiga, Japan) in 10 μL volume. Forward and reverse primers for different cytokines are shown in Table 2. All primers were obtained from Cosmogentech (Seoul, Korea). The RT-PCR sample (10 µL) was loaded into each lane of a 1% ethidium bromide agarose gel and then visualized with UV Transilluminator from VILBER LOURMAT (Marne-la-Vallée, France). Use ImageJ to measure protein grey values.

Table 2. Primers for cytokines measurement
Gene Forward primer Reverse primer
β-actin ACCAACTGGGACGACATGGA GTGATGACCTGGCCGTCAG
IL-1β AGAGATGGCGTTCGTTCCC GCAGTCAGCGCCCACTTA
IL-1RN ATTGGGGCATCTCATGGGTG GCTCAGCACAGCTGGAAGTA
IL-6 AGAAGCCGCACCATGAACTT TGGTAACAGAGGATTGTGCCC
TNFα ATGACCACGCTCTTTCCGT TTAATCCACTCCCACCACCC

β-actin, beta-actin; IL-1β, interleukin-1 beta; IL-1RN, interleukin 1 receptor antagonist; IL-6, interleukin 6; TNFα, tumor necrosis factor.

Download Excel Table
Microflora change on cecum

Three broilers were randomly taken from each group for sampling, totalling 12 samples. After cutting off the cecum, it was immediately stored in ice and transported back to the laboratory for microbiological enumeration. Intestinal contents were collected into sterile test tubes (50 mL) in a sterile environment. The number of surviving bacteria was counted within 24 hours using standard agar culture methods on deMan Rogosa Sharpe (MRS; Difco), nutrient broth, MacConkey (Difco), and Streptococcus thermophilus (ST) standard agar plates. Coliforms and lactose-negative enterobacteria on MacConkey agar, total bacteria on normal nutrient agar, lactic acid bacteria (LAB) on MRS agar, and streptococci on ST agar were counted. All intestinal contents after treatment were sampled. Subsequently, 1g of each sample was serially diluted with sterilised distilled water. After being evenly distributed throughout the prepared medium, the diluted suspension was placed there and allowed to incubate for 24 to 48 hours at 37°C. Colonies were enumerated and represented as log CFU/g following incubation.

The previously reported procedures were followed for the PCR conditions, DNA extraction, bioinformatics, and NGS sequencing analysis [16]. In short, a PowerSoil DNA isolation kit (Mobio Laboratories, Carlsbad, CA, USA) was used for isolating genomic DNAs. Using 341F and 785R primers, the V3–V4 region of the bacterial 16S rRNA gene was amplified. Using an Illumina MiSeq platform through a Macrogen (Seoul, Korea) commercial service, sequencing was done.

Statistical analysis

Data were examined in a completely randomized design using SAS 9.4's PROC mixed process (SAS Institute, Cary, NC, USA). Differences in means among treatment groups were determined using Tukey’s test. Data variability was expressed as pooled standard error of mean (SEM). A p-value of < 0.05 indicates statistical significance. a–dMean within a column within a main effect are significantly different.

RESULTS

Antibacterial activity of Poly-p

Seven pathogenic bacteria harmful to poultry (Listeria monocytogenes, Shigella sonnei, Salmonella enterica ser. Gallinarum, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella enterica ser. Pullorum, Escherichia coli O157:H7) were tested for antibacterial activity (Table 3). SCPP did not exhibit bacteriostatic activity. While MCPP and LCPP produced inhibitory effects on four pathogens including Shigella sonnei, Pseudomonas aeruginosa, Salmonella enterica ser. Pullorum, and Escherichia coli O157:H7. It is worth noting that MCPP presents a higher diameter of the inhibition circle than that of LCPP, so the inhibitory activity of MCPP is higher than that of LCPP.

Table 3. Antibacterial effect of different length Polyphosphates for pathogenic bacteria
Strain Inhibition zone (mm)1)
P3 P14 P130
Listeria monocytogenes ND ND ND
Shigella sonnei ND 20.76 ± 0.09 15.99 ± 0.62
Salmonella enterica ser. Gallinarum ND ND ND
Klebsiella pneumoniae ND ND ND
Pseudomonas aeruginosa ND 11.00 ± 0.65 9.89 ± 0.74
Salmonella enterica ser. Pullorum ND 13.78 ± 0.15 10.20 ± 0.20
Escherichia coli O157:H7 ND 10.70 ± 0.30 9.56 ± 0.89

P3, short chain polyphosphates; P14, medium chain polyphosphates chain polyphosphates; P130, long chain polyphosphates.

ND; not detected.

Download Excel Table
Effects of SCPP, MCPP, and LCPP on organs

The effects of SCPP, MCPP, and LCPP on organ are shown in Table 4. The intervention of SCPP showed slightly reduced tendency of liver weight and increased jejunal length compared to the control NC group (p < 0.05). LCPP showed reduced tendency of liver weight (p < 0.05) and slightly increased jejunal length compared to the control group.

Table 4. Effect of different length polyphosphates for tissue and organ
Response parameter Treatment1) SEM p-value
NC P3 P14 P130
Weights (g)
 Body weight 1,753 1,794 1,883 1,724 0.04 0.0684
 Liver 2.06a 1.84ab 1.93a 1.56b 0.07 0.0079
 Spleen 0.11 0.11 0.09 0.08 0.02 0.5453
 Fabricius of bursa 0.17 0.14 0.14 0.11 0.03 0.4099
 Breast 9.80 9.83 10.70 10.41 0.39 0.3340
 Single leg 6.05 6.07 5.76 6.20 0.16 0.3303
Length (cm)
 Duodenum 26.87 30.73 25.00 29.50 1.86 0.2046
 Jejunum 62.93b 79.00a 65.47ab 71.47ab 3.16 0.0288
 Ileum 62.50 71.10 65.30 75.07 4.42 0.2562
 Cecum 16.70 18.74 17.47 19.17 0.89 0.2557
Length to body weight ratio (%)
 Duodenum 1.59 1.59 1.41 1.61 0.17 0.8391
 Jejunum 3.71 4.07 3.70 3.87 0.34 0.8498
 Ileum 3.68 3.65 3.68 4.08 0.37 0.8236
 Cecum 0.99 0.97 0.98 1.04 0.09 0.9515

NC, basal diet; P3, basal diet + 0.05% short chain polyphosphates; P14, basal diet + 0.05% medium chain polyphosphates; P130, basal diet + 0.05% Long chain polyphosphates.

Values with different letters in the same column are significantly different at p < 0.05.

Download Excel Table
Effects of SCPP, MCPP, and LCPP on meat quality

In meat quality (Table 5), SCPP, MCPP, and LCPP did not show any effects except for the decreased lightness of MCPP at cooking loss (p < 0.05). However, LCPP increased it compared to MCPP.

Table 5. Effect of different length polyphosphates for meat quality
Item2) Treatment1) SEM p-value
NC P3 P14 P130
pH 5.73 5.76 5.81 5.70 0.06 0.5718
Cooking loss (%) 17.16 17.07 15.63 20.10 0.99 0.0669
L* 60.35ab 61.18ab 59.50b 62.00a 0.55 0.0187
a* 1.66 2.25 1.72 1.81 0.19 0.1444
b* 2.52 2.95 2.60 3.11 0.38 0.6503

NC, basal diet; P3, basal diet + 0.05% short chain polyphosphates; P14, basal diet +0.05% medium chain polyphosphates; P130, basal diet + 0.05% long chain polyphosphates.

Values with different letters in the same column are significantly different at p < 0.05.

Download Excel Table
Effects of SCPP, MCPP, and LCPP on serum

Effects of LCPP, MCPP, and SCPP on serum are shown in Fig. 1. Results showed that LCPP increased the level of glucose (Fig. 1D) in the body (p < 0.05). SCPP decreased the level of triglycerides (Fig. 1G) in vivo compared to control NC, whereas LCPP increased the level of triglycerides (both p < 0.05).

jast-67-4-853-g1
Fig. 1. Effect of different length polyphosphates for serum. (A) Gamma-glutamyl triglyceride (GGT). (B) Glutamate oxaloacetate transaminase (GOT). (C) Glutamate pyruvate transaminase (GPT). (D) Glucose (GLU). (E) Blood urea nitrogen (BUN). (F) Creatine (CRE). (G) Triglycerides (TG). (h) Total protein (TP). (I) Albumin (ALB). (J) High density lipoprotein (HDLC). (K) Uric acid (UA), (L) Total cholesterol (TCHO). * p < 0.05.
Download Original Figure
Effects of SCPP, MCPP, and LCPP on anti-inflammation

Poly-p affected the expression of pro-inflammatory cytokines in the intestine (Fig. 2A). All treatment groups showed lower IL-1β expression in the ileum and jejunum, while polymers MCPP and LCPP enhanced IL-1β expression in the cecum. More interesting to note that while IL-6 and TNFα were not expressed in these tissues, the anti-inflammatory cytokine IL-1RN was expressed constitutively at extremely low levels (Figs. 2B, 2C, and 2D).

jast-67-4-853-g2
Fig. 2. Expression of four different avian pro-inflammatory cytokine genes (A), interleukin-1β (IL-1β), IL-1 receptor antagonist (IL-1RN), IL-6, and tumor necrosis factor (TNF-α), in three intestinal organs, jejunum (B), ileum (C), and cecum(d) after feeding three different polymers (P3, P14, and P130) were examined with RT-PCR. NC, negative control; P3, short chain polyphosphates; P14, medium chain polyphosphates; P130, long chain polyphosphates. a-dMean within a column within a main effect are significantly different (p < 0.05). RT-PCR, real-time polymerase chain reaction.
Download Original Figure
Microflora change on cecum

According to the CFU of bacteria count statistics (Table 6). SCPP was able to increase the abundance of Lactobacillus in the cecum and decrease the abundance of coliform bacteria. Subsequently, MCPP and LCPP also reduced the abundance of coliform bacteria and Shigella and Salmonella in the cecum compared to control NC.

Table 6. Effect of different length polyphosphates for intestinal microorganisms
Item (logCFU/g) Treatment1) SEM p-value
NC P3 P14 P130
Total microbes 9.33ab 9.60a 9.28ab 9.08b 0.13 0.0486
Lactobacilli 9.02bc 9.63a 9.4ab 8.67c 0.15 0.0006
Coliform bacteria 8.79a 8.35b 7.96c 8.14bc 0.10 < 0.0001
Shigella and Salmonella 8.67a 8.40ab 8.05b 8.22b 0.10 0.0008

NC, basal diet; P3, basal diet + 0.05% short chain polyphosphates; P14, basal diet + 0.05% medium chain polyphosphates; P130, basal diet + 0.05% long chain polyphosphates.

Values with different letters in the same column are significantly different at p < 0.05.

Download Excel Table

Table 7 shows the alpha-diversity indices (ASVs, Chao1, Shannon, and Gini-Simpson) for the gut microbiota of broilers ingesting SCPP, MCPP, and LCPP. In the P14 group, the Asvs and Chao1 indices were significantly stronger than in the NC group (p < 0.05). Regarding beta diversity (Figs. 3G and 3H), the principal coordinates analysis (PCoA) plots with weighted Unifrac distances clearly showed that the microbial colonies formed confidence zones between groups, and the confidence triangles of the bacterial communities in the P130 treatment group area deviated significantly from those of the NC group. Meanwhile, PD_whole_tree (UPGMA) showed comparable species homology between the other treatment groups and the NC group.

Table 7. Effect of different length polyphosphates for microbial alpha indicators of cecum
Item1) NC2) P3 P14 P130 SEM p-value
ASVs 398b 388b 461.67a 397.67b 13.8 0.0187
Chao1 400.57b 388.23b 468.54a 398.64b 14.1 0.0136
Shannon 6.72 6.3 6.48 6.61 0.2 0.5247
Simpson 0.97 0.94 0.96 0.97 0.01 0.2455

ASVs, bacterial amplicon sequence variants, Chao1, community richness; Shannon, number and homogeneity of species; Simpson, probability that any two individuals drawn from a community belong to different species.

NC, basal diet; P3, basal diet + 0.05% short chain polyphosphates; P14, basal diet + 0.05% medium chain polyphosphates; P130, basal diet + 0.05% long chain polyphosphates.

Values with different letters in the same column are significantly different at p < 0.05.

Download Excel Table

To determine the changes in the gut flora after SCPP, MCPP, and LCPP interventions, the microbiological components were analysed. The microflora in the cecum of broiler chickens at the phylum level mainly consisted of Bacteroidetes (31.4%) and Firmicutes (65.01%). Two superior species, Bacteroidetes and Firmicutes, accounted for ∼95% of the total microorganisms in relative abundance (Fig. 3A, Table 8).

Table 8. Effect of different chain length polyphosphates on phylum and genus in the intestinal flora
Item Treatment1) SEM p-value
NC P3 P14 P130
Phylum (%)
 Bacteroidetes 30 32 29 34 5 0.9196
 Firmicutes 67 65 66 62 6 0.9274
 Lentisphaerae 0.01 0.01 0.01 0.0067 0.009 0.9444
 Proteobacteria 1.18 1.06 1.11 1.11 0.076 0.7246
 Tenericutes 0.077 0 0.003 0.05 0.04 0.5005
 Others 1.65 1.95 3.05 2.27 0.38 0.1257
Genus (%)
 Bacteroides 12.03a 1.76b 1.93b 4.89ab 2.18 0.0325
 Phocaeicola 4.56b 17.23ab 17.88ab 21.26a 3.44 0.0388
 Barnesiella 5.92b 17.91a 5.9b 3.91b 2.48 0.0145
 Faecalibacterium 3.65b 4.52ab 4.16b 10.67a 1.42 0.0256
 Streptococcus 3.07 6.01 5.93 2.06 2.75 0.6713
 Eubacterium 0.07 0.07 0.21 1.37 0.33 0.0679
 Blautia 4.66 2.37 4.21 5.32 0.94 0.2256
 Lachnoclostridium 2.44 1.78 1.70 2.20 0.22 0.1375
 Saccharofermentans 1.06 0.53 0.22 0.36 0.39 0.4788
 Romboutsia 5.53 5.76 8.12 3.73 1.79 0.4352
 Turicibacter 1.50 2.08 2.31 1.25 0.30 0.121
 Ligilactobacillus 0.76 0.81 0.46 0.25 0.20 0.2292
 Pseudescherichia 0.25 0.14 0.14 0.09 0.06 0.4213
 Mediterraneibacter 8.86 9.91 8.32 7.25 1.64 0.7207
 Others 41.51 39.64 42.10 40.06 2.39 0.8683

NC, basal diet; P3, basal diet + 0.05% short chain polyphosphates; P14, basal diet + 0.05% medium chain polyphosphate; P130, basal diet + 0.05% long chain polyphosphate.

Mean in the same row, with significant differences indicated between values marked differently above (p ≤ 0.05).

Download Excel Table

Fig. 3B depicts the classification components of the gut flora at the genus level. Phocaeicola (15.23%) and Mediterraneibacter (8.59%) stood out from the rest of the microflora, and these two bacteria accounted for the largest percentage. Four dominant bacterial families were chosen to analyse the variations in the gut microbiota compositions in various samples (Figs. 3C, 3D, 3E, and 3F, Table 8). The relative abundance of some Bacteroides was significantly lower in groups P3 and P14 compared to the control NC. However, the abundance of Phocaeicola and Faecalibacterium were higher in the P130 group than in the control NC, and the abundance of Barnesiella were higher in the P14 group than in the control NC (both p < 0.05).

jast-67-4-853-g3
Fig. 3. Effect of different length polyphosphates for intestinal flora in cecum. (A) Phylum level. (B–F) Relative abundances of the gut microbiota at the genus level. (G,H) PCoA analysis based on Bray-Curtis distance and phylogenetic tree of the cecum microbiota, where the confidence interval is 95%. a–dMean within a column within a main effect are significantly different (p < 0.05, n = 3). PCoA, principal coordinates analysis.
Download Original Figure

DISCUSSION

A Poly-p derivative was found to have higher antibacterial activity against Gram-positive bacteria than against Gram-negative bacteria [17]. There is a possibility that Poly-p can isolate metal ions to stabilize, thus reducing the availability of nutrients to cells and making cells gradually become apoptotic [7,18]. In the presence of LCPP, cell envelopes of Staphylococcus aureus and Bacillus cereus are damaged. It is worth stating that 0.05% Poly-p inhibits spore germination and growth, while high concentrations (1.0%) of Poly-p can even kill spores [19,20]. On the other hand, certain gram-negative bacteria appear to be resistant to antibacterial properties of Poly-p, and none of the high concentrations seemed to have an effect [21,22]. Notably, compared to gram-negative bacteria, gram-positive bacteria have far higher requirements for Mg2+, which may be one of the reasons why gram-positive bacteria are more sensitive to Poly-p [23]. Results of the present study, MCPP and SCPP inhibited the growth performance of most of the pathogenic bacteria.

Liver weight is generally considered to be proportional to body weight [24]. Although Moon et al. [15] concluded that long-chain Poly-p at a concentration of 0.1% would not affect the liver of broilers. But, high (1.0%) or low (0.1%) dietary inorganic phosphate intake can negatively affect liver development in mice, another study reported that adding 10% sodium trimetaphosphate to the diet of mice resulted in disrupted liver growth and development [25,26]. This experiment will not exclude the possibility of liver-induced toxic reactions at certain doses It is widely recognised that an increase in the length of the gut may not be a good thing. The reduction and enlargement of chicken intestinal volume may reflect the organism’s nutrient absorption capacity and utilisation efficiency [27]. When long-chain Poly-p are added, the jejunum, ileum, and cecum get shorter and lighter [15]. For broiler carcass quality assessment, meat brightness, redness and pH are considered [28]. Poly-p are used as antioxidants in food products [29]. In this experiment, SCPP, MCPP, and LCPP did not affect the meat quality of broilers except for the lightness at cooking loss. Variation in myoglobin denaturation and color of cooked beef, pork, and turkey meat were influenced by concentration of sodium tripolyphosphate [30].

The ability of broilers to deposit fat is correlated with triglycerides, it is a class of neutral lipids that is essential to the body's ability to produce cells, metabolize them, and use them as a source of energy [31,32]. From the results, the increase in triglycerides levels and glucose levels did not affect the broiler's own body weight. Poly-p activities are dependent on chain length. Phosphate polymerization may therefore be essential for promoting an inflammatory response. When a Poly-p chain included more than 65 monomers, its effects on lipopolysaccharide-induced macrophage inflammation were more pronounced, and previous results have shown that Poly-p-amplified lipopolysaccharide could induce inflammatory responses of macrophages, which provides a new therapeutic target for inflammatory diseases [33]. High levels of Poly-p can reduce the ability of neutrophils and macrophages to phagocytose bacteria and decrease the expression of macrophage attracting chemokines (such as CCL2 and CXCL10) and activating interferon beta in a Poly-p dose and chain length dependent manner [34]. Cytokines of the IL-1RN and IL-1β are essential in controlling the inflammatory responses of the gastrointestinal mucosa [35]. Poly-p bring the internal intestinal flora into balance [7]. Lactobacillus are gram-positive bacteria that are healthy for the intestinal tract [36]. It has been found that 700 pi chain length of Poly-p accumulated in Lactobacillus paracasei is effective in promoting a healthy gut [37]. There are a wide variety of coliform bacteria, Shigella, and Salmonella most of which can have a direct impact on gut health [38,39]. In this result, SCPP, MCPP and LCPP all increased the number of beneficial bacteria in the intestinal tract and controlled the number of harmful bacteria, which improved the structure of the intestinal environment and promoted the nutrient absorption of the organism.

The intestinal microbiota profoundly influences intestinal homeostasis, not only affecting intestinal metabolites but also regulating intestinal immune homeostasis [40]. The study of alpha and beta indices was analysed herein, with the results showing that SCPP, MCPP, and LCPP increased the homology and diversity of microorganisms in the cecum, with MCPP being the most effective. At the phylum level, Bacteroidetes and Firmicutes were above 95%. SCPP and MCPP reduced the abundance values of some of the Bacteroides. A significant proportion of the Bacteroides were harmful species, such as Bacteroidesvulgatus and Bacteroides fragilis, both of which are commonly associated with cases of inflammation and abscesses [41]. Subsequently, LCPP can increase the abundance of Phocaeicola and Faecalibacterium. Phocaeicola's metabolite (3-Hydroxyphenylacetic acid) can alleviate fatty liver disease associated with metabolic dysfunction and is a beneficial bacterium [42]. Faecalibacterium is a butyrate producer and has been shown to possess anti-inflammatory properties both in vivo and in vitro, with the potential to be a key member of gut microbiota homeostasis [43]. SCPP increased the abundance of Barnesiella. Barnesiella is a valuable microorganism that can help cyclophosphamide for tumour immunosurveillance [44]. Therefore, it is suggested that the intervention of SCPP, MCPP, and LCPP changes the structure of the intestinal flora, increases its diversity, promotes the growth of beneficial bacteria in the intestinal tract, and inhibits the growth of harmful bacteria.

CONCLUSION

In summary, SCPP, MCPP, and LCPP all have antibacterial properties, can promote anti-inflammatory properties, improve intestinal microflora and serum status, and the effect is comparable to antibiotics. Among the three Poly-p with different chain lengths, MCPP has better effect than SCPP and LCPP. More importantly, SCPP, MCPP, and LCPP have no toxic side effects and can be an important basis for the use of antimicrobial feed additives for poultry.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-2022R1F1A1073956).

Acknowledgements

Not applicable.

Availability of data and material

The data analyzed during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

Conceptualization: Moon SG, Kim SK.

Data curation: Chang YQ, Kim SK.

Formal analysis: Chang YQ, Jeon SW, Hwang WU.

Methodology: Chang YQ.

Software: Chang YQ.

Validation: Chang YQ.

Investigation: Chang YQ, Wang YQ, Lee AR.

Writing - original draft: Chang YQ.

Writing - review & editing: Chang YQ, Moon SG, Wang YQ, Jeon SW, Lee AR, Kim SH, Hwang WU, Kim SK.

Ethics approval and consent to participate

The experimental protocol used in this study was approved by the Animal Care and Use Committee (IACUC) of Konkuk University, Korea (approval number: KU23227).

References

1.

Kornberg A. Inorganic polyphosphate: toward making a forgotten polymer unforgettable. J Bacteriol. 1995; 177:491-6

2.

Kumble KD, Kornberg A. Inorganic polyphosphate in mammalian cells and tissues. J Biol Chem. 1995; 270:5818-22

3.

Morrissey JH, Choi SH, Smith SA. Polyphosphate: an ancient molecule that links platelets, coagulation, and inflammation. Blood. 2012; 119:5972-9

4.

Kulakovskaya TV, Vagabov VM, Kulaev IS. Inorganic polyphosphate in industry, agriculture and medicine: modern state and outlook. Process Biochem. 2012; 47:1-10

5.

Smith SA, Mutch NJ, Baskar D, Rohloff P, Docampo R, Morrissey JH. Polyphosphate modulates blood coagulation and fibrinolysis. Proc Natl Acad Sci USA. 2006; 103:903-8

6.

Wang Y, Li M, Li P, Teng H, Fan D, Du W, et al. Progress and applications of polyphosphate in bone and cartilage regeneration. BioMed Res Int. 2019; 2019:5141204

7.

Obritsch JA, Ryu D, Lampila LE, Bullerman LB. Antibacterial effects of long-chain polyphosphates on selected spoilage and pathogenic bacteria. J Food Prot. 2008; 71:1401-5

8.

Shi X, Kornberg A. Endopolyphosphatase in Saccharomyces cerevisiae undergoes post-translational activations to produce short-chain polyphosphates. FEBS Lett. 2005; 579:2014-8

9.

Seidlmayer LK, Gomez-Garcia MR, Shiba T, Porter GA Jr, Pavlov EV, Bers DM, et al. Dual role of inorganic polyphosphate in cardiac myocytes: the importance of polyP chain length for energy metabolism and mPTP activation. Arch Biochem Biophys. 2019; 662:177-89

10.

Shiba T. Inorganic polyphosphate and its chain-length dependency in tissue regeneration including bone remodeling and teeth whitening.In In: Kulakovskaya T, Pavlov E, Dedkova E, editors.editors Inorganic polyphosphates in eukaryotic cells. Cham: Springer. 2016; p. 139-58

11.

Lager KJ, Brouk MJ, Bradford BJ, Harner JP. Impact of supplemental phosphorus source on phosphorus utilization in lactating dairy cattle [Internet]. Kansas Agricultural Experiment Station. 2009cited 2024 April 4https://krex.k-state.edu/server/api/core/bitstreams/77b593a4-58ba-46e9-9f1e-7a96ec90ea15/content

12.

Elliott RP, Straka RP, Garibaldi JA. Polyphosphate inhibition of growth of pseudomonads from poultry meat. Appl Microbiol. 1964; 12:517-22

13.

Froning GW. Effect of polyphosphates on binding properties of chicken meat. Poult Sci. 1965; 44:1104-7

14.

Kornegay ET. Supplementation of lysine, ammonium poly-phosphate and urea in diets for growing-finishing pigs. J Anim Sci. 1972; 34:55-63

15.

Moon SG, Kothari D, Kim WL, Lee WD, Kim KI, Kim JI, et al. Feasibility of sodium long chain polyphosphate as a potential growth promoter in broilers. J Anim Sci Technol. 2021; 63:1286-300

16.

Niu KM, Khosravi S, Kothari D, Lee WD, Lim JM, Lee BJ, et al. Effects of dietary multi-strain probiotics supplementation in a low fishmeal diet on growth performance, nutrient utilization, proximate composition, immune parameters, and gut microbiota of juvenile olive flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2019; 93:258-68

17.

Lebrini M, Bentiss F, Chihib NE, Jama C, Hornez JP, Lagrenée M. Polyphosphate derivatives of guanidine and urea copolymer: inhibiting corrosion effect of Armco iron in acid solution and antibacterial activity. Corros Sci. 2008; 50:2914-8

18.

Lorencová E, Vltavská P, Budinský P, Koutný M. Antibacterial effect of phosphates and polyphosphates with different chain length. J Environ Sci Health A Tox Hazard Subst Environ Eng. 2012; 47:2241-5

19.

Maier SK, Scherer S, Loessner MJ. Long-chain polyphosphate causes cell lysis and inhibits Bacillus cereus septum formation, which is dependent on divalent cations. Appl Environ Microbiol. 1999; 65:3942-9

20.

Lee RM, Hartman PA, Stahr HM, Olson DG, Williams FD. Antibacterial mechanism of long-chain polyphosphates in Staphylococcus aureus. J Food Prot. 1994; 57:289-94

21.

Buňková L, Pleva P, Buňka F, Valášek P, Kráčmar S. Antibacterial effects of commercially available phosphates on selected microorganisms. Acta Univ Agric Silvic Mendel Brun. 2014; 56:19-24

22.

Fusieger A, da Silva RR, de Jesus Silva SR, Honorato JA, Teixeira CG, Souza LV, et al. Inhibitory activity of an emulsifying salt polyphosphate (JOHA HBS®) used in processed cheese: an in vitro analysis of its antibacterial potential. LWT. 2022; 167:113777

23.

Zaika LL, Kim AH. Effect of sodium polyphosphates on growth of Listeria monocytogenes. J Food Prot. 1993; 56:577-80

24.

Qureshi AA, Burger WC, Prentice N, Bird HR, Sunde ML. Regulation of lipid metabolism in chicken liver by dietary cereals. J Nutr. 1980; 110:388-93

25.

Weiner ML, Salminen WF, Larson PR, Barter RA, Kranetz JL, Simon GS. Toxicological review of inorganic phosphates. Food Chem Toxicol. 2001; 39:759-86

26.

Hong SH, Park SJ, Lee S, Kim S, Cho MH. Biological effects of inorganic phosphate: potential signal of toxicity. J Toxicol Sci. 2015; 40:55-69

27.

Wang X, Farnell YZ, Peebles ED, Kiess AS, Wamsley KGS, Zhai W. Effects of prebiotics, probiotics, and their combination on growth performance, small intestine morphology, and resident Lactobacillus of male broilers. Poult Sci. 2016; 95:1332-40

28.

Vieira V, Marx FO, Bassi LS, Santos MC, Oba A, de Oliveira SG, et al. Effect of age and different doses of dietary vitamin E on breast meat qualitative characteristics of finishing broilers. Anim Nutr. 2021; 7:163-7

29.

Watts BM. Polyphosphates as synergistic antioxidants. J Am Oil Chem Soc. 1950; 27:48-51

30.

Trout GR. Variation in myoglobin denaturation and color of cooked beef, pork, and turkey meat as influenced by pH, sodium chloride, sodium tripolyphosphate, and cooking temperature. J Food Sci. 1989; 54:536-40

31.

Han X, Ye H. Overview of lipidomic analysis of triglyceride molecular species in biological lipid extracts. J Agric Food Chem. 2021; 69:8895-909

32.

Zhou Y, Chen Z, Lin Q, Yang Y, Hang Y, Zhou X, et al. Nuciferine reduced fat deposition by controlling triglyceride and cholesterol concentration in broiler chickens. Poult Sci. 2020; 99:7101-8

33.

Ito T, Yamamoto S, Yamaguchi K, Sato M, Kaneko Y, Goto S, et al. Inorganic polyphosphate potentiates lipopolysaccharide-induced macrophage inflammatory response. J Biol Chem. 2020; 295:4014-23

34.

Bowlin MQ, Gray MJ. Inorganic polyphosphate in host and microbe biology. Trends Microbiol. 2021; 29:1013-23

35.

Garcia-Gonzalez MA, Lanas A, Santolaria S, Crusius JBA, Serrano MT, Peña AS. The polymorphic IL-1B and IL-1RN genes in the aetiopathogenesis of peptic ulcer. Clin Exp Immunol. 2001; 125:368-75

36.

de Vries MC, Vaughan EE, Kleerebezem M, de Vos WM. Lactobacillus plantarum—survival, functional and potential probiotic properties in the human intestinal tract. Int Dairy J. 2006; 16:1018-28

37.

Saiki A, Ishida Y, Segawa S, Hirota R, Nakamura T, Kuroda A. A Lactobacillus mutant capable of accumulating long-chain polyphosphates that enhance intestinal barrier function. Biosci Biotechnol Biochem. 2016; 80:955-61

38.

Safaei HG, Jalali M, Hosseini A, Narimani T, Sharifzadeh A, Raheimi E. The prevalence of bacterial contamination of table eggs from retails markets by Salmonella spp., Listeria monocytogenes, Campylobacter jejuni and Escherichia coli in Shahrekord, Iran. Jundishapur J Microbiol. 2011; 4:249-53

39.

Mani S, Wierzba T, Walker RI. Status of vaccine research and development for Shigella. Vaccine. 2016; 34:2887-94

40.

Xie L, Chen T, Qi X, Li H, Xie J, Wang L, et al. Exopolysaccharides from genistein-stimulated Monascus purpureus ameliorate cyclophosphamide-induced intestinal injury via PI3K/AKT-MAPKs/NF-κB pathways and regulation of gut microbiota. J Agric Food Chem. 2023; 71:12986-3002

41.

Zafar H, Saier MH. Gut Bacteroides species in health and disease. Gut Microbes. 2021; 13e1848158

42.

Jin S, Chen P, Yang J, Li D, Liu X, Zhang Y, et al. Phocaeicola vulgatus alleviates diet-induced metabolic dysfunction-associated steatotic liver disease progression by downregulating histone acetylation level via 3-HPAA. Gut Microbes. 2024; 16:2309683

43.

Miquel S, Martín R, Rossi O, Bermúdez-Humarán LG, Chatel JM, Sokol H, et al. Faecalibacterium prausnitzii and human intestinal health. Curr Opin Microbiol. 2013; 16:255-61

44.

Daillère R, Vétizou M, Waldschmitt N, Yamazaki T, Isnard C, Poirier-Colame V, et al. Enterococcus hirae and Barnesiella intestinihominis facilitate cyclophosphamide-induced therapeutic immunomodulatory effects. Immunity. 2016; 45:931-43