RESEARCH ARTICLE

Effects of dietary supplementation of illite and bentonite in weaned piglets challenged with Escherichia coli

Jihwan Lee1,#https://orcid.org/0000-0001-8161-4853, Dongcheol Song2,#https://orcid.org/0000-0002-5704-603X, Seungwon Jung2,#https://orcid.org/0009-0004-5592-7097, Jiseon An2,#https://orcid.org/0000-0002-9205-8095, Seyeon Chang2https://orcid.org/0000-0002-5238-2982, Kyeongho Jeon2https://orcid.org/0000-0003-2321-3319, Hyuck Kim2https://orcid.org/0000-0002-5280-0734, Jinmo Yang2https://orcid.org/0009-0007-4272-3441, Jinho Cho2,*https://orcid.org/0000-0001-7151-0778
Author Information & Copyright
1Swine Science Division, National Institute of Animal Science, Rural Development Administration, Cheonan, Korea
2Department of Animal Science, Chungbuk National University, Cheongju, Korea
*Corresponding author: Jinho Cho, E-mail: jinhcho@chungbuk.ac.kr

# These authors contributed equally to this work.

© Copyright 2026 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Apr 01, 2025; Revised: May 23, 2025; Accepted: Jul 05, 2025

Published Online: Jul 31, 2026

Abstract

The objective of this study was to investigate the effects of illite (IT) and bentonite (BE) on growth performance and intestinal health in weaned pigs challenged with Escherichia coli. A total of 24 (Duroc × Yorkshire × Landrace) weaned pigs (initial body weight: 9.61 ± 0.65 kg, 28 ± 3 days old) were assigned to six treatments with four replicates per treatment. Pigs were housed in individual pens for 17 days, including a 3-day adaptation period and 14 days after the first E. coli challenge. In the E. coli-challenged groups, all pigs were orally inoculated with a total of 10 mL of E. coli for three consecutive days. The experiment was conducted in a 2 × 3 factorial arrangement of treatments consisting of two challenge levels (challenged and non-challenged) and three types of clay mineral (non-supplemented, IT, and BE). IT and BE were included in the diets at 1% and 1.5%, respectively. E. coli challenge reduced (p < 0.05) ADG, ADFI, G:F during the entire experimental period and lowered (p < 0.05) serum interleukin-8, interleukin-10, malondialdehyde (MDA), and interferon-gamma (IFN-γ) levels on D 3. However, in the E. coli-challenged group, IT supplementation improved (p < 0.05) G:F compared to the non-supplemented group during the first week. Additionally, IT supplementation increased (p < 0.05) blood IFN-γ and mucin expression levels compared to the non-supplemented group in the challenged groups. At the end of the experiment, intestinal morphology and intestinal immunity were evaluated to assess intestinal health. E. coli challenge reduced (p < 0.05) villus height and tight junction protein expression while increasing (p < 0.05) crypt depth. In the E. coli-challenged group, BE supplementation increased (p < 0.05) villus height and the expression of tight junction proteins compared to the non-supplemented group. Additionally, IT supplementation in E. coli challenge increased (p < 0.05) mucin expression levels in the intestine compared to the non-supplemented group. Inconclusion, dietary supplementation with IT and BE mitigates the adverse effects of E. coli infection and suggests their potential as effective additives for managing E. coli challenges.

Keywords: Weaned piglet; Escherichia coli challenge; Clay mineral; Illite; Bentonite

INTRODUCTION

Early weaning techniques are commonly used in modern intensive farming systems to boost sow productivity and economic benefits [1]. Nonetheless, weaning stress may adversely affect piglets’ intestinal microbiota, physiological and biochemical functions, digestion, and absorption [2]. As a consequence of weaning stress, piglets’ intestinal environments are susceptible to invasion by pathogenic microorganisms such as Escherichia coli [3].

Natural clay minerals (CMs) are naturally occurring rock or soil materials composed predominantly of fine-grained minerals, which exhibit high pliability when hydrated. Based on their structures and physico-chemical properties (particle size, surface charge, and adsorption capability), CMs can be used in a wide range of applications [4]. Illite (IT) is characterized by a large specific area and two tetrahedral sheets sandwiched between two octahedral sheets with an ability to absorb large amounts of water and a high capacity to exchange cations (CEC) [5]. Bentonite (BE) composed predominantly of smectite is characterized by its submicrometer crystal size, sheet-like structure, significant surface area, negative charge, and CEC [6]. Due to their characteristics, CMs are significant for gastrointestinal disease medications, anti-infective agents, and nutritional supplements [7]. According to Muniyappan et al. [8], supplementation of IT can improve feed efficiency and digestibility in pigs. Horky et al. [9] have also reported that supplementation of BE can reduce oxidative stress and protect jejunal tissue. Therefore, this study hypothesized that dietary supplementation of IT and BE could mitigate intestinal health and growth performance of nursery pigs. To test this hypothesis, effects of IT and BE on intestinal health and growth performance of nursery pigs challenged with E. coli were investigated.

MATERIALS AND METHODS

Bacterial strains, culture and challenge

E. coli KCTC 2571 was supplied from Korean Collection for Type Cultures (KCTC) in a lyophilized state and suspended in sterile distilled water. The 10 μL of the suspended E. coli was added to luria-bertani broth (LB broth, KisanBio) and cultured at 37°C for 18 hours with shaking. Thereafter, the subcultured E. coli was smeared on MacConkey agar to confirm the bacterial enumeration. A final concentration of 1.2 × 1010 CFU/mL was used in this study.

Animals, experimental design and diets

A total of 24 (Duroc × Yorkshire × Landrace) weaned pigs (initial body weight of 9.61 ± 0.65 kg and 28 ± 3 d old), were assigned to 6 treatments with 4 replicates per treatment. Pigs were housed in individual pens for 17 days, including 3 days adaption period and 14 days after the first E. coli challenge (0 d). The experiment was conducted in a 2 × 3 factorial arrangement of treatments consisting of two levels of challenge (challenge and non-challenge) and three levels of CM (non-supplementation, IT and BE). Corn and soybean meal basal diets were formulated to meet or exceed the nutrient requirements for the weaned piglets as recommended by NRC (Table 1) [10]. The pigs were fed daily at 8:30 and 17:00 h and had ad libitum access to water. Feed residues were removed before the next meal and considered in the calculations. In the E. coli challenge treatments, all pigs were orally inoculated by dividing a total of 10 mL of E. coli for 3 consecutive days. Challenged piglets and non-challenged piglets were housed in a separate room. Strict biosecurity procedures were followed to avoid E. coli contamination of the non-challenged piglets.

Table 1. Compositions of basal diets (as-fed-basis)
Items content
Ingredients (%)
 corn 34.43
 extruded corn 15.00
 lactose 10.00
 Dehulled soybean meal (51% CP)1) 13.50
 Soy protein concentrate (65% CP)1) 10.00
 Plasma powder 6.00
 Whey 5.00
 Soy oil 2.20
 Monocalcium phosphate 1.26
 Limestone 1.40
L-Lysine-HCl (78%) 0.06
DL-Methionine (50%) 0.15
 Choline chloride (25%) 0.10
 Vitamin premix2) 0.25
 Trace mineral premix3) 0.25
 Salt 0.40
 Total 100
Calculated value
 ME (Kcal/kg) 3,433
 CP (%) 20.76
 Lysine (%) 1.35
 Methionine (%) 0.39
 Ca 0.82
 P 0.65
Analyzed value
 ME (kcal/kg) 3,512
 CP (%) 20.92

1) Crude protein.

2) Provided per kg of complete diet: vitamin A, 11,025 IU; vitamin D3, 1103 IU; vitamin E, 44 IU; vitamin K, 4.4 mg; ribofavin, 8.3 mg; niacin, 50 mg; thiamine, 4 mg; d-pantothenic, 29 mg; choline, 166 mg; and vitamin B12, 33 mg.

3) Provided per kg of complete diet without Zinc: Cu (as CuSO4•5H2O), 12 mg; Mn (as MnO2), 8 mg; I (as KI), 0.28 mg; and Se (as Na2SeO3•5H2O), 0.15 mg.

CP, crude protein; ME, metabolizable energy.

Download Excel Table
Growth performance

All piglets were weighed every week during the experiment period and feed consumption was recorded to calculate average daily gain (ADG), average daily feed intake (ADFI), and gain to feed ratio (G:F).

Nutrient digestibility

To estimate digestibility, 0.2% chromium oxide (Cr2O3) was supplemented with diets as an indigestible marker. Pigs were fed diets mixed with chromium oxide for 4 consecutive days from 4 and 11 d, fresh excreta samples were collected in that period. At the end of the experiment, fecal samples were stored at –20°C and dried at 70°C for 72 h, and then, ground to pass through a 1 mm screen. All analysis items (feed and fecal) were analyzed for DM and CP. The procedures utilized for the determination of dry matter (DM) and crude protein (CP) digestibility were conducted with the methods by AOAC [11]. Chromium was analyzed with an ultraviolet absorption spectrophotometer (UV-1201, Shimadzu). The digestibility was calculated using the following formula: digestibility (%) = (1 – [Nf × Cd] / [Nd × Cf]) × 100, where Nf is the nutrient concentration in feces (% DM), Nd is the nutrient concentration in diet (% DM), Cd is the chromium concentration in diet (% DM), and Cf is the chromium concentration in feces (% DM).

Morphological analysis of small intestine

At the end of the experiment (14 d), pigs were anesthetized with carbon dioxide gas after blood sampling and euthanized by exsanguination. Intestinal tissues of about 10 cm from the ileum (close to the ileocecal junction) were collected and fixed in 10% neutral buffered formalin (NBF; Sigma-Aldrich). After cutting the intestine sample, it was dehydrated and dealcoholized. The samples were then installed on slides, treated with paraffin, and stained with hematoxylin and eosin. Villus height (VH) and crypt depth (CD) were measured under the light microscope (OLYMPUS DP71, BX50F-3, Olympus). VH was determined by measuring the distance between the tip of the villi to the villus crypt junction, and CD was determined by measuring the distance between adjacent villi.

Blood profile

Blood samples were obtained from jugular vein of 6 pigs each treatment at 0, 3 and 14 d. The samples were collected in K3EDTA tube for complete blood count analysis and nonheparinized tubes for serum analysis, respectively. White blood cells (WBC) were analyzed using an automatic hematology analyzer (XE2100D, Sysmex). Interleukin-10 (IL-10; P8000, R&D systems) and interferon-γ (IFN-γ; DY985, R&D systems) were measured using commercially available ELISA kits.

Real-time quantitative RT-PCR analysis

The Total RNA extraction kit (iNtRON Biotechnology) was used to extract the RNA from the intestinal mucosa. The mRNA was converted to cDNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). For cDNA synthesis, the mixed solution was heat treated at 25°C for 10 min, at 37°C for 2 h, and at 85°C for 5 min. Gene amplification was performed using Fast qPCR 2×SYBR Green Master Mix (Applied Biosystems). RT-qPCR was performed in two steps. The first step was an enzyme activation step, which was performed at 95°C for 2 min for 1 cycle. The second step was a denaturation step at 95°C for 15 seconds and an annealing/extend step at 56°C for 1 min, repeating a total of 40 cycles to perform gene amplification. The target genes were zonula occludens-1 (ZO-1), claudin-1 (CLDN-1), mucin-1 (MUC-1) and Glyceraldehyde-3-phosphate dehydrogenase 2 (GAPDH). Primers used in the amplification are shown in Table 2. Normalization was performed using the reference gene GAPDH. Relative gene expression was analyzed using the 2−ΔΔCt method [12].

Table 2. Primer sequences used for the RT-qPCR analysis with the Muc1, ZO-1, CLDN1, and GAPDH genes
Gene Primers Sequence (5’-3’)
GAPDH Forward TCGGAGTGAACGGATTTGGC
Reverse TGACAAGCTTCCCGTTCTCC
MUC-1 Forward CCACAACCTGAAGACACAGT
Reverse GACCAGAATACAGACCAGCA
ZO-1 Forward CTCTGTCCATGCAGATAAGC
Reverse AATAGCTCCCTGTGGGATAA
CLDN1 Forward GCTGGGACTAATAGCCATCT
Reverse AAGAGAGCCTGACCAAATTC

GAPDH, glyceraldehyde-3-phosphate dehydrogenase 2; MUC-1, mucin-1; ZO-1, zonula occludens-1; CLDN1, claudin-1.

Download Excel Table
Statistical analysis

JMP Pro 16 (SAS Institute) and GraphPad Prism (ver. 9.1.0, GraphPad Software) were used for statistical analyses and graph visualization, respectively. All data were analyzed via two-way analysis of variance (ANOVA) using the Standard Least Squares model, with each pen as the experimental unit. The statistical model included the effect of E. coli challenge (C–, C+), the effect of CM supplementation (non, IT and BE) and the interaction between E. coli and CM.

RESULTS

Growth performance

Effects of dietary supplementing IT and BE on growth performance in weaned piglets challenged with E. coli are presented in Table 3. E. coli challenge decreased (p < 0.05) final BW compared with non-challenged group. Also, E. coli challenge decreased (p < 0.05) ADG and ADFI compared with non-challenged group in whole experiment period. There was an interaction between E. coli challenge and CM in G:F. pigs supplemented with IT with E. coli challenge improved (p < 0.05) G:F compared to non-supplemented group with E. coli on 1 wk.

Table 3. Effect of dietary supplementing illite and bentonite on growth performance in weaned piglets challenged with Escherichia coli
Items C+ C– SE Mi C p-value
- IT BE - IT BE - IT BE + - Mi C Mi×C
BW (kg)
 D-3 9.62 9.61 9.62 9.60 9.61 9.60 0.365 9.67 9.61 9.61 1.000
 D0 10.13 10.11 10.14 10.14 10.15 10.13 0.370 10.13 10.13 10.13 0.999
 D7 11.22 11.56 11.49 11.82 12.05 11.77 0.383 11.52 11.80 11.63 11.42 11.88 0.756 0.160 0.915
 D14 12.93 13.32 13.17 13.86 14.05 13.70 0.385 13.40 13.69 13.43 13.14 13.87 0.718 0.032 0.873
ADG (g)
 D-3 to 0 126.88 123.75 130.00 133.75 135.63 131.25 10.485 130.31 129.69 130.63 0.996
 D0 to 7 155.71 207.14 192.86 240.00 271.43 234.29 8.367 197.86b 239.29a 213.57b 185.24 238.57 < 0.001 < 0.001 0.061
 D7 to 14 244.64 251.79 240.00 292.14 286.07 275.36 16.032 268.39 268.93 257.68 245.48 284.52 0.735 0.008 0.901
 D0 to 14 200.18 229.46 216.43 266.07 278.75 254.82 9.671 233.13 254.11 235.63 215.36 266.55 0.087 < 0.001 0.379
ADFI (g)
 D-3 to 0 194.19 198.00 193.00 193.88 197.00 193.00 6.466 194.03 197.50 193.00 0.770
 D0 to 7 299.00 317.00 313.00 352.07 383.00 366.00 5.603 325.54b 350.00a 339.50ab 309.67 367.02 0.002 < 0.001 0.427
 D7 to 14 414.00 406.00 389.00 409.00 346.00 414.00 33.719 411.50 376.00 40.50 403.00 389.67 0.565 0.634 0.457
 D0 to 14 356.00 361.00 351.00 380.25 402.00 390.00 7.398 368.13 381.50 370.50 356.00 390.75 0.184 < 0.001 0.480
G:F (g/g)
 D-3 to 0 0.65 0.62 0.68 0.69 0.69 0.68 0.053 0.67 0.66 0.68 0.924
 D0 to 7 0.52b 0.65a 0.62ab 0.68a 0.71a 0.64a 0.026 0.60b 0.68a 0.63ab 0.60 0.68 0.018 0.001 0.040
 D7 to 14 0.59 0.62 0.62 0.71 0.68 0.67 0.039 0.68 0.65 0.64 0.61 0.69 0.958 0.027 0.596
 D0 to 14 0.56 0.64 0.62 0.70 0.69 0.65 0.027 0.63 0.66 0.64 0.60 0.68 0.402 0.002 0.168

a,b Values within a row with different superscripts are significantly different.

C, challenge; Mi, clay mineral; IT, illite; BE, bentonite; BW, body weight; ADG, average daily gain; ADFI, average daily feed intake G:F, feed efficiency.

Download Excel Table
Nutrient digestibility

Effects of dietary supplementing IT and BE on nutrient digestibility in weaned piglets challenged with E. coli are presented in Table 4. Pigs supplemented with BE showed higher (p < 0.05) CP digestibility than non-supplemented group.

Table 4. Effect of dietary supplementing illite and bentonite on nutrient digestibility in weaned piglets challenged with Escherichia coli
Items C+ C– SE Mi C p-value
- IT BE - IT BE - IT BE + - Mi C Mi×C
1 wk
 DM 79.75 80.28 80.48 80.53 80.70 80.65 0.647 80.14 80.49 80.56 80.17 80.63 0.786 0.394 0.893
 CP 70.33 71.94 72.57 72.89 73.84 74.78 0.807 71.61b 72.89ab 73.67a 71.61 73.84 0.049 0.002 0.919
 GE 81.12 81.41 81.14 81.81 82.40 81.91 0.564 81.47 81.91 81.53 81.23 82.04 0.695 0.087 0.967
2 wk
 DM 79.36 79.64 79.53 79.58 79.90 79.83 0.774 79.47 79.77 79.68 79.51 79.77 0.923 0.691 0.998
 CP 71.40 72.15 71.81 73.68 72.89 72.85 0.124 72.54 72.52 72.33 71.79 73.14 0.983 0.189 0.806
 GE 80.99 82.17 81.61 81.06 82.27 81.57 0.850 81.03 82.22 81.59 81.59 81.64 0.386 0.944 0.997

a,b Values within a row with different superscripts are significantly different.

C, challenge; Mi, clay mineral; IT, illite; BE, bentonite; DM, dry matter; CP, crude protein; GE, gross energy.

Download Excel Table
Intestinal morphology

Effects of dietary supplementing IT and BE on intestinal morphology in weaned piglets challenged with E. coli are presented in Table 5. There was an interaction between E. coli challenge and CM in VH. Pigs supplemented with BE with E. coli challenge showed higher (p < 0.05) VH compared to non-supplemented group with E. coli. Also, E. coli challenge decreased (p < 0.05) VH:CD compared with non-challenged group.

Table 5. Effect of dietary supplementing illite and bentonite on intestinal morphology in weaned piglets challenged with Escherichia coli
Items C+ C– SE Mi C p-value
- IT BE - IT BE - IT BE + - Mi C Mi×C
VH 318.02c 362.00bc 366.00ab 394.34ab 408.75a 385.34ab 10.856 356.18b 385.37a 375.60ab 348.67 396.14 0.035 < 0.001 0.045
CD 183.74 187.35 198.47 172.80 179.48 179.32 6.112 178.27 183.41 188.90 189.85 177.20 0.237 0.017 0.639
VH:CD 1.74 1.94 1.85 2.31 2.29 2.16 0.092 2.02 2.12 2.00 1.84 2.25 0.444 < 0.001 0.315

a–c Values within a row with different superscripts are significantly different.

C, challenge; Mi, clay mineral; IT, illite; BE, bentonite; VH, villus height; CD, crypt depth; VH:CD, villus height to crypt depth ratio.

Download Excel Table
Blood profile

Effects of dietary supplementing IT and BE on blood profile in weaned piglets challenged with E. coli are presented in Table 6. On D3, E. coli challenged group showed lower (p < 0.05) WBC, IL-8, IL-10, MDA, IFN-γ and IgG than non-challenged group. Also, there was an interaction between E. coli challenge and CM. pigs supplemented with IT with E. coli challenge showed higher (p < 0.05) IFN-γ than pigs challenged with E. coli on D3.

Table 6. Effect of dietary supplementing illite and bentonite on blood profile in weaned piglets challenged with Escherichia coli
Item C+ C– SE Mi C p-value
- IT BE - IT BE - IT BE + - Mi C Mi×C
D0
 IL-8 2,044.29 2,061.94 2,062.17 2,057.01 2,077.15 2,071.31 203.862 2,050.65 2,069.55 2,066.74 2,056.13 2,068.49 0.995 0.941 1.000
 IL-10 43.68 44.61 43.49 45.43 44.85 42.98 2.912 44.56 44.73 43.23 43.93 44.42 0.855 0.837 0.925
 MDA 70.77 84.89 63.31 72.89 71.94 83.49 11.091 71.83 78.42 73.40 72.99 76.11 0.826 0.732 0.336
 IFN-γ 190.57 164.99 192.10 187.51 189.35 175.70 21.662 189.04 177.17 183.90 182.56 184.19 0.860 0.927 0.634
D3
 IL-8 2,231.93 3,021.26 2,706.83 1,885.84 1,800.97 1,827.35 222.309 2,058.89 2,411.11 2,267.09 2,653.34 1,838.05 0.292 < 0.001 0.153
 IL-10 49.90 64.81 54.59 46.33 44.60 48.25 4.226 48.11 54.71 51.42 56.44 46.39 0.306 0.006 0.121
 MDA 123.71 130.34 117.87 74.60 82.82 85.95 10.029 99.15 106.58 101.91 123.97 81.12 0.757 < 0.001 0.642
 IFN-γ 242.16b 341.81a 283.42b 177.17c 175.40c 175.27c 13.443 209.66b 258.61a 229.35ab 289.13 175.95 0.003 < 0.001 0.002
D14
 IL-8 1,915.27 2,005.14 2,261.69 2,090.19 1,953.23 1,995.16 170.927 2,002.73 1,979.19 2,128.43 2,060.70 2,012.86 0.647 0.734 0.441
 IL-10 51.67 49.61 48.39 48.63 52.80 52.79 2.522 50.15 51.21 50.59 49.89 51.41 0.916 0.465 0.296
 MDA 84.19 95.62 88.91 77.37 75.92 73.07 11.557 80.78 85.77 80.99 89.58 75.46 0.888 0.142 0.850
 IFN-γ 183.84 174.37 161.38 155.29 139.03 154.77 20.934 169.57 156.70 158.08 173.20 149.70 0.797 0.176 0.774

a–c Values within a row with different superscripts are significantly different.

C, challenge; Mi, clay mineral; IT, illite; BE, bentonite; WBC, white blood cell; IgG, immunoglobulin G; IL-8, interleukin-8; IL-10, Interleukin-10; MDA, malondialdehyde; IFN-γ, interferon γ; SE, standard error.

Download Excel Table
Tight junction protein

Effects of dietary supplementing IT and BE on TJ protein in weaned piglets challenged with E. coli are presented in Table 7. There was an interaction between E. coli challenge and CM in MUC-1, CLDN-1 and ZO-1. Pigs supplemented IT with E. coli challenge showed higher (p < 0.05) MUC-1 than pigs challenged with E. coli. Also, Pigs supplemented BE with E. coli challenge showed higher (p < 0.05) CLDN-1 and ZO-1 than pigs challenged with E. coli.

Table 7. Effect of dietary supplementing illite and bentonite on tight junction in weaned piglets challenged with Escherichia coli
Item C+ C– SE Mi C p-value
- IT BE - IT BE - IT BE + - Mi C Mi×C
MUC-1 0.82b 1.25a 1.17ab 1.00ab 0.90ab 0.85b 0.075 0.91 1.07 1.01 1.08 0.92 0.140 0.020 0.007
CLDN-1 0.82b 1.18ab 1.23a 1.00ab 0.87ab 0.83b 0.081 0.91 1.03 1.03 1.08 0.90 0.270 0.021 0.008
ZO-1 0.84b 1.15ab 1.24a 1.00ab 0.90ab 0.86b 0.075 0.92 1.02 1.05 1.08 0.92 0.232 0.023 0.008

a,b Values within a row with different superscripts are significantly different.

C, challenge; Mi, clay mineral; IT, illite; BE, bentonite; MUC-1, mucin-1; CLDN-1, claudin-1; ZO-1, zonula occludens-1; SE, standard error.

Download Excel Table

DISCUSSION

The objective of this study was to investigate effects of natural IT and BE on growth performance and intestinal health of weaned piglets challenged with E. coli. In the current study, E. coli infection significantly decreased BW, ADG, and ADFI of piglets. This result is consistent with previous studies showing that weaning stress and pathogenic challenges can severely impact growth performance [13,14]. Reductions of growth parameters can be due to intestinal epithelial damage, decreased nutrient absorption, and increased energy expenditure for immune response [15,16]. IT supplementation improved the G:F ratio during the first week of infection. The zinc content in IT might enhance intestinal barrier function by regulating TJ protein expression [17,18]. Additionally, layered silicate structure of IT can adsorb toxins in the gastrointestinal tract, potentially reducing negative impacts of E. coli infection [19,20]. These mechanisms may contribute to improved nutrient utilization efficiency and growth performance. BE supplementation increased CP digestibility. This could be attributed to high CEC and swelling properties [21,22]. These characteristics may increase intestinal retention time, enhance enzyme-substrate interactions, and improve nutrient digestibility [21]. Improved protein digestion can support intestinal health and immune function, leading to enhanced growth performance [23,24].

E. coli infection decreased the VH:CD, indicating intestinal mucosal damage. This result is consistent with previous studies showing that reduction in VH can lead to decreased nutrient absorption capacity and contribute to growth retardation [25]. BE supplementation increased VH in piglets challenged with E. coli. Water retention capacity of BE might protect and promote regeneration of intestinal mucosa [26].

Three days post-infection, E. coli challenged groups showed decreased white blood cell (WBC) counts and levels of cytokines (IL-8, IL-10, IFN-γ, and IgG). These results are similar to immune suppression caused by weaning stress [27], suggesting that E. coli toxins might have impaired immune cell function. IT supplementation increased IFN-γ levels in piglets challenged with E. coli. The copper content in IT might enhance macrophage function and improve defense against pathogens [28,29]. This indicates that IT’s immunomodulatory effects may lead to improved resistance to infections.

E. coli infection is known to increase oxidative stress in the intestine. E. coli infection decreased TJ protein expression, consistent with previous studies showing that weaning stress and pathogenic challenges could compromise intestinal barrier function [30,31]. Reduced TJ protein expression can increase intestinal permeability, promoting pathogen invasion and inflammation [32,33]. IT supplementation increased MUC-1 expression, while BE supplementation increased CLDN-1 and ZO-1 expression. The manganese in IT might act as a cofactor for enzymes to protect against DNA oxidative damage, contributing to cell [34,35]. BE may form a protective layer on the intestinal mucosa, shielding epithelial cells from E. coli toxins [36,37]. These increases in TJ protein expression can strengthen the intestinal barrier function, thus preventing pathogen invasion and reducing inflammation [30,38].

Immune modulation mechanisms of IT and BE are not completely understood yet. For IT, its trace minerals may directly regulate immune cell functions. For example, zinc can promote T lymphocyte activation and proliferation, while copper can enhance macrophage function. For BE, its immune modulation effects are likely to be mainly indirect. BE can prevent excessive activation of the immune system by adsorbing intestinal toxins. Additionally, protective effect of BE on the intestinal mucosa may help maintain the function of gut-associated lymphoid tissues.

In conclusion, this study demonstrates that IT and BE supplementation has the potential to improve intestinal health and growth performance of E. coli-challenged weaned piglets. IT and BE appear to support piglet health through distinct mechanisms. IT primarily acts through trace mineral supply to enhance immune function and toxin adsorption, while BE can improve nutrient digestibility and intestinal mucosal protection.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This research was supported by “Regional Innovation Strategy (RIS)” through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (MOE) (2021RIS-001).

Acknowledgements

Not applicable.

Availability of data and material

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Authors’ contributions

Conceptualization: Lee J, Song D, Cho J.

Data curation: Chang S, Jeon K, Kim H.

Formal analysis: Lee J, Song D.

Methodology: Jung S, An J, Chang S.

Software: Jeon K, Kim H, Yang J.

Validation: Lee J, Song D, Jung S, An J.

Investigation: Lee J, Song D.

Writing - original draft: Lee J, Song D, Jung S, An J.

Writing - review & editing: Lee J, Song D, Jung S, An J, Chang S, Jeon K, Kim H, Yang J, Cho J.

Ethics approval and consent to participate

The protocol for this study was reviewed and approved by the Institutional Animal Care and Use Committee of Chungbuk National University, Cheongju, Korea (approval no. CBNUA-24-0013-02).

Declaration of generative AI

No AI tools were used in this article.

REFERENCES

1.

Tang X, Xiong K, Fang R, Li M. Weaning stress and intestinal health of piglets: a review. Front Immunol. 2022; 13:1042778

2.

Yu L, Li H, Peng Z, Ge Y, Liu J, Wang T. Early weaning affects liver antioxidant function in piglets. Animals. 2021; 11:2679

3.

Ji FJ, Wang LX, Yang HS, Hu A, Yin YL. Review: the roles and functions of glutamine on intestinal health and performance of weaning pigs. Animal. 2019; 13:2727-35

4.

Damato A, Vianello F, Novelli E, Balzan S, Gianesella M, Giaretta E, et al. Comprehensive review on the interactions of clay minerals with animal physiology and production. Front Vet Sci. 2022; 9:889612

5.

Szczerba M, McCarty DK, Derkowski A, Kowalik M. Molecular dynamics simulations of interactions of organic molecules found in oil with smectite: influence of brine chemistry on oil recovery. J Petrol Sci Eng. 2020; :107148

6.

Deng Z, Jang KB, Jalukar S, Du X, Kim SW. Efficacy of feed additive containing bentonite and enzymatically hydrolyzed yeast on intestinal health and growth of newly weaned pigs under chronic dietary challenges of fumonisin and aflatoxin. Toxins. 2023; 15:433

7.

Feng Y, Chen X, He RR, Liu Z, Lvov YM, Liu M. The horizons of medical mineralogy: structure-bioactivity relationship and biomedical applications of halloysite nanoclay. ACS Nano. 2024; 18:20001-26

8.

Muniyappan M, Shanmugam S, Kim IH. Effects of dietary supplementation of illite on growth performance, nutrient digestibility, and meat-carcass grade quality of growing-finishing pigs. J Anim Sci Technol. 2024; 66:115-24

9.

Horky P, Gruberova HA, Aulichova T, Malyugina S, Slama P, Pavlik A, et al. Protective effect of a new generation of activated and purified bentonite in combination with yeast and phytogenic substances on mycotoxin challenge in pigs. PLOS ONE. 2021; 16e0259132

10.

NRC (National Research Council). Nutrient requirements of swine. 11th edThe National Academies Press. 2012

11.

AOAC (Association of Official Analytical Chemists) International. Official methods of analysis of AOAC International. 18th rev. edAOAC International. 2007

12.

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001; 25:402-8

13.

Duarte ME, Garavito-Duarte Y, Kim SW. Impacts of F18+ Escherichia coli on intestinal health of nursery pigs and dietary interventions. Animals. 2023; 13:2791

14.

Boeckman JX, Sprayberry S, Korn AM, Suchodolski JS, Paulk C, Genovese K, et al. Effect of chronic and acute enterotoxigenic E. coli challenge on growth performance, intestinal inflammation, microbiome, and metabolome of weaned piglets. Sci Rep. 2022; 12:5024

15.

Cui C, Wu C, Wang J, Ma Z, Zheng X, Zhu P, et al. Restored intestinal integrity, nutrients transporters, energy metabolism, antioxidative capacity and decreased harmful microbiota were associated with IUGR piglet’s catch-up growth before weanling. J Anim Sci Biotechnol. 2022; 13:129

16.

Bayer F, Dremova O, Khuu MP, Mammadova K, Pontarollo G, Kiouptsi K, et al. The interplay between nutrition, innate immunity, and the commensal microbiota in adaptive intestinal morphogenesis. Nutrients. 2021; 13:2198

17.

Hou G, Zhang M, Wang J, Zhu W. Chitosan-chelated zinc modulates ileal microbiota, ileal microbial metabolites, and intestinal function in weaned piglets challenged with Escherichia coli K88. Appl Microbiol Biotechnol. 2021; 105:7529-44

18.

Jang KB, Moita VHC, Martinez N, Sokale A, Kim SW. Efficacy of zinc glycinate reducing zinc oxide on intestinal health and growth of nursery pigs challenged with F18+ Escherichia coli. J Anim Sci. 2023; 101:skad035

19.

Subramaniam MD, Kim IH. Clays as dietary supplements for swine: a review. J Anim Sci Biotechnol. 2015; 6:38

20.

Mun D, Lee J, Choe J, Kim B, Oh S, Song M. Value of clay as a supplement to swine diets. Korean J Agric Sci. 2017; 44:181-7

21.

Horky P, Nevrkla P, Kopec T, Bano I, Skoric M, Skladanka J, et al. Is a new generation of mycotoxin clay adsorbents safe in a pig’s diet?. Porcine Health Manag. 2022; 8:31

22.

Elliott CT, Connolly L, Kolawole O. Potential adverse effects on animal health and performance caused by the addition of mineral adsorbents to feeds to reduce mycotoxin exposure. Mycotoxin Res. 2020; 36:115-26

23.

Deng Z, Duarte ME, Jang KB, Kim SW. Soy protein concentrate replacing animal protein supplements and its impacts on intestinal immune status, intestinal oxidative stress status, nutrient digestibility, mucosa-associated microbiota, and growth performance of nursery pigs. J Anim Sci. 2022; 100:skac255

24.

Humphrey B, Zhao J, Faris R. Link between intestinal immunity and practical approaches to swine nutrition. Animal. 2019; 13:2736-44

25.

Wang M, Yang C, Wang Q, Li J, Huang P, Li Y, et al. The relationship between villous height and growth performance, small intestinal mucosal enzymes activities and nutrient transporters expression in weaned piglets. J Anim Physiol Anim Nutr. 2020; 104:606-15

26.

Nadziakiewicza M, Kehoe S, Micek P. Physico-chemical properties of clay minerals and their use as a health promoting feed additive. Animals. 2019; 9:714

27.

de Groot N, Fariñas F, Cabrera-Gómez CG, Pallares FJ, Ramis G. Weaning causes a prolonged but transient change in immune gene expression in the intestine of piglets. J Anim Sci. 2021; 99:skab065

28.

Liao P, Li M, Li Y, Tan X, Zhao F, Shu X, et al. Effects of dietary supplementation with cupreous N-carbamylglutamate (NCG) chelate and copper sulfate on growth performance, serum biochemical profile and immune response, tissue mineral levels and fecal excretion of mineral in weaning piglets. Food Agric Immunol. 2017; 28:1315-29

29.

Espinosa CD, Fry RS, Usry JL, Stein HH. Effects of copper hydroxychloride and choice white grease on growth performance and blood characteristics of weanling pigs kept at normal ambient temperature or under heat stress. Anim Feed Sci Technol. 2019; 256:114257

30.

Yu E, Chen D, Yu B, Huang Z, Mao X, Zheng P, et al. Manno-oligosaccharide attenuates inflammation and intestinal epithelium injury in weaned pigs upon enterotoxigenic Escherichia coli K88 challenge. Br J Nutr. 2021; 126:993-1002

31.

Chang SY, Song MH, Lee JH, Oh HJ, Kim YJ, An JW, et al. Phytogenic feed additives alleviate pathogenic Escherichia coli-induced intestinal damage through improving barrier integrity and inhibiting inflammation in weaned pigs. J Anim Sci Biotechnol. 2022; 13:107

32.

Song D, Lee J, Kwak W, Song M, Oh H, Kim Y, et al. Stimbiotic supplementation alleviates poor performance and gut integrity in weaned piglets induced by challenge with E. coli. Animals. 2022; 12:1799

33.

Chang SY, Lee JH, Oh HJ, An JW, Song DC, Cho HA, et al. Effect of different ratios of phytogenic feed additives on growth performance, nutrient digestibility, intestinal barrier integrity, and immune response in weaned pigs challenged with a pathogenic Escherichia coli. J Anim Sci. 2023; 101:skad148

34.

Hutfilz CR, Wang NE, Hoff CA, Lee JA, Hackert BJ, Courcelle J, et al. Manganese is required for the rapid recovery of DNA synthesis following oxidative challenge in Escherichia coli. J Bacteriol. 2019; 201:1-14

35.

Singh N, Savanur MA, Srivastava S, D’Silva P, Mugesh G. A manganese oxide nanozyme prevents the oxidative damage of biomolecules without affecting the endogenous antioxidant system. Nanoscale. 2019; 11:3855-63

36.

Trckova M, Vondruskova HP, Zraly Z, Zajacova ZS, Kummer V, Alexa P. The effect of dietary bentonite on post-weaning diarrhoea, growth performance and blood parameters of weaned piglets. Appl Clay Sci. 2014; 90:35-42

37.

Chang S, Lee J, Jung S, Song D, Park S, Jeon K, et al. Effects of illite or bentonite on cytotoxicity, antibacterial and adsorption capacity in porcine intestinal epithelial cells. Journal of Animal Science and Technology. 2024

38.

Zou Y, Xiang Q, Wang J, Peng J, Wei H. Oregano essential oil improves intestinal morphology and expression of tight junction proteins associated with modulation of selected intestinal bacteria and immune status in a pig model. BioMed Res Int. 2016; 2016:5436738

Revised Publication Charge


(Effective for articles submitted beginning January 1, 2026)

The publication charge is 1,500,000 Korean Won per article for members of the Korean Society of Animal Science and Technology (KSAST), and 2,000,000 Korean Won for non-members. First and corresponding authors are required to pay the annual membership fee.

The publication charge for a corresponding author outside Korea is 1,500 US dollars per article.


I don't want to open this window for a day.