RESEARCH ARTICLE

Dietary supplementation with L-glutamine enhances immunity and reduces heat stress in Hanwoo steers under heat stress conditions

Yves Kamali1,#https://orcid.org/0000-0002-7405-5106, Yong Ho Jo1,#https://orcid.org/0000-0002-9842-5765, Won-Seob Kim2https://orcid.org/0000-0002-0234-5665, Jalil Ghassemi Nejad1https://orcid.org/0000-0001-6578-8829, Jae-Sung Lee1https://orcid.org/0000-0001-8940-9862, Hong-Gu Lee1,*https://orcid.org/0000-0002-0679-5663
Author Information & Copyright
1Department of Animal Science and Technology, Sanghuh College of Life Sciences, Konkuk University, Seoul 05029, Korea
2Department of Animal Science, Michigan State University, East Lansing, MI 48824, USA
*Corresponding author Hong Gu Lee, Department of Animal Science and Technology, Sanghuh College of Life Sciences, Konkuk University, Seoul 05029, Korea. Tel: +82-2-450-0523 E-mail: hglee66@konkuk.ac.kr

#These authors contributed equally to this work.

© Copyright 2022 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Jun 15, 2022; Revised: Aug 18, 2022; Accepted: Sep 28, 2022

Published Online: Nov 30, 2022

Abstract

This study investigated the effects of L-glutamine (Gln) supplementation on growth performance, physiological traits, heat shock proteins (HSPs), and gene expression related to muscle and adipose tissue development in Hanwoo steers under heat stress (HS) conditions. Eight Hanwoo steers (initial body weight [BW] 570.7 ± 43.6 kg, months of age 22.3 ± 0.88) were randomly separated into two groups, control and treatment, and supplied with the concentration (1.5% of BW kg/day/head) and rice straw (1.5 kg/day/head). The treatment group were fed the Gln supplementation (0.5% of concentration, as-fed basis) once a day at 08:00 h. Blood samples for the assessment of haematological and biochemical parameters and the separation of peripheral blood mononuclear cells (PBMCs) were collected four times, at 0, 3, 6, and 10 weeks of the experiment. Feed intake was measured daily. BW to analyze growth performance and hair follicle collection to analyze the expression of HSPs were executed four times at 0, 3, 6, and 10 weeks. To analyze gene expression, longissimus dorsi muscle samples were collected by biopsy at the end of the study. As a result, growing performance, including final BW, average daily gain, and gain-to-feed ratio, were not different between the two groups. Leukocytes including lymphocytes and granulocytes, tended to increase in the Gln supplementation group (p = 0.058). There were also no differences in biochemical parameters shown between the two groups, except total protein and albumin, both of which were lower in the Gln supplementation group (p < 0.05). Gene expressions related to muscle and adipose tissue development were not different between the two groups. As temperature–humidity index (THI) increased, HSP70 and HSP90 expression in the hair follicle showed a high correlation. HSP90 in the hair follicle was decreased in the treatment group compared with the control group at 10 weeks (p < 0.05). Collectively, dietary Gln supplementation (0.5% of concentration, as-fed basis) may not be influential enough to affect growth performance and gene expression related to muscle and adipose tissue development in steers. However, Gln supplementation increased the number of immune cells and decreased HSP90 in the hair follicle implying HS reduction in the corresponding group.

Keywords: L-Glutamine; Hanwoo steer; Heat shock protein; Heat stress; Immunity

INTRODUCTION

Korea is a peninsula surrounded by the sea on three sides with hot and humid summers, experiencing an average temperature of 24.4°C (mean minimum temperature of 20.7°C, and mean maximum temperature of 29.1°C) and relative humidity (RH) of 77.3% from 2011 to 2021 [1]. In general, beef cattle require more energy due to the increased maintenance energy requirement for thermo-emission, while the energy intake decreases with diminished feed intake during heat stress (HS) [2]. Energy for beef cattle is important because limited energy causes reduced growth performances and productivity. Under HS conditions, insulin secretion increases, resulting in increased glucose absorption in cells and inhibited lipolysis in fat tissue compared with thermoneutral conditions. In addition, insulin inhibits beta-oxidation, which synthesizes energy using fat and increases the availability of monosaccharide glucose and amino acids (AAs) [3,4]. Additionally, protein metabolism is suppressed under HS. As the phenomena continue, first, blood flows into peripheral tissues to dissipate heat, the blood flow to digestive organs reduces, and the absorption of nutrition, including AAs, also reduces [5]. Second, HS inhibits ammonia utilization of the ruminal microbes and reduces the proliferation of ruminal microbes, which eventually results in a decline in ruminal microbial protein synthesis [6,7]. Third, the production of heat shock protein (HSP) 70, which is a protein that prevents the denaturation of other proteins in HS, increases by 200 times in lymphocytes due to HS [8]. Finally, the amount of glucogenic AAs in the blood reduces by approximately 17.1% followed by the production of glucose due to the negative energy balance caused by HS [9]. However, supplementing heat stressed cows with a high dosage of dietary protein could reduce productivity due to an excessive urea cycle [10], thus the optimum dosage, or its component (AA), should be identified with regard to the different physiological effects.

Glutamine (Gln) is a conditionally essential AA in the body of ruminants associated with normal physiological functions, lipid and protein metabolism, and muscle growth [1113]. Gln is also responsible for various functions in the body including: 1) synthesizing other AAs using Gln; 2) increasing immunity with a proliferation of lymphocyte and increasing-decreasing cytokines; and 3) using respiratory fuel in the mitochondria of intestinal epithelial cells and myocytes [14,15]. Our hypothesis is that the supplementation of glutamine will reduce HS and improve immunity in a lack of energy and protein supply due to reduced intake during HS, and furthermore, it has a positive effect on genes related muscle development.

A previous study in our laboratory revealed that in vitro supplementation with Gln at 0.5% has positive effects on fermentation end products (VFAs) and on the degradability of nutrients without adverse effects on ammonia-N or total gas production compared with 2% and 3% supplementation [16]. However, in vivo studies investigating the effects of Gln supplementation on beef cattle under HS conditions are scant. Moreover, the possible effects of Gln on the prevention of excessive nitrogen sourced from dietary nitrogen in Hanwoo steers under HS has yet to be investigated. Therefore, and following the previous in vitro study in our laboratory [16], the objective of this study was to explore the effects of Gln supplementation on growth performance, physiological traits, HSPs, and gene expression related to muscle development in Hanwoo steers under HS conditions.

MATERIALS AND METHODS

Animals, treatments, feeding, and housing management

All experimental procedures were followed according to the Konkuk University “Guidelines for the Care and Use of Experimental Animals” (Approval no: KU20001). Originally, eight Korean native beef cattle were included in this study. The animals (initial body weight [BW] = 570.7 kg [SD = 43.6], months of age = 22.3 [SD = 0.88]) were randomly separated into two groups (supplemented Gln group, n = 4; control group, n = 4).

The diets were supplied with a commercial concentration (Hanwoo-love-max, Cargill, Seongnam, Korea) (1.5% of BW as-fed basis) and 1.5 kg of rice straw (as-fed basis) (Table 1). The animals were fed quantitatively according to 1.5% of BW at 08:00 and 16:00 h. The feed residual was measured daily at 07:00 h. BW was measured at 0, 3, 6, and 10 weeks. After evaluating BW, the amount of feeding was reset based on the measured BW. Water was available ad libitum. In the treatment group, an additional average of 51.45 g Gln/day/head (SD = 3.41, Daesang, Seoul, Korea) was supplied via oral administration to each animal for 9 weeks, except for an adaptation period of 1 week. The experiment period was from 27 June to 13 September, 2020, although the summer period in Korea starts from 31 May and ends in September (approximately 4 months) [17]. The amount of Gln fed to the animals was 0.5% of the total diet on an as-fed basis. According to a previous study, the addition of more than 2% Gln showed negative effects on rumen fermentation and a degradability of nutrients in-vitro; however, Gln at an amount of 0.5% of the total diet improved rumen fermentation and the degradability of nutrients [16]. The steers were housed in the same individual 5 m2 pens (2 m [length] × 2.5 m [breadth]).

Table 1. Composition and nutrient content of experimental diets for steer (DM basis)
Items Concentrate1) Rice straw
Chemical composition (DM, %)
 Moisture 4.70 12.29
 Crude protein 15.35 4.45
 Ether extraction 3.37 1.74
 Neutral detergent fiber 25.43 66.70
 Acid detergent fiber 7.66 45.13
 Non-fiber carbohydrate2) 47.58 12.43
 Crude ash 8.27 14.68
 Ca 0.78 0.33
 P 0.44 0.13
 Total digestible nutrition3) 75.0 43.66
 Digestible energy4) 3.31 1.93

1) Commercial feed (Cargill Agri Purina, Seoul, Korea).

2) Calculated value using NRC [18] equation is 100 - (CP + EE + NDF - NDIP + ASH).

3) Calculated value using NRC [18] equation is truly digestible (td)NFC + tdCP + (tdFA × 2.25) + tdNDF -7.

4) Calculated value using NRC [19] equation is 0.04409 × TDN.

DM, dry matter; CP, crude protein; EE, ether extract; NDF, neutral detergent fiber; NDIP, neutral detergent insoluble protein; NFC, nonfiber carbohydrate; FA, fatty acid; TDN, total digestible nutrients.

Download Excel Table
Rectal temperature and behavior parameters under heat stress

Two experimenters visually checked the behavior parameters from 10:00 to 18:00 h four times at 0, 3, 6, and 10 weeks. The frequency of lying and standing at 0, 3, 6, and 10 weeks was calculated from 10:00 to 18:00 h. The rectal temperature (RT) was checked for four times at 0, 3, 6, 10 weeks at 14:00 h.

Measurement of temperature–humidity index

The THI was recorded inside and outside the barn at 1 second intervals using a sensor (MHB-382SD, ZL 2008 2, Lutron, Shanghai, China), and the daily average (00:00 to 24:00) values of ambient temperature and RH were calculated. The THI was calculated based on dry bulb temperature (Tdb) and RH using the following formula: THI = (1.8 × Tdb + 32) – [(0.55 – 0.0055 × RH) × (1.8 × Tdb – 26.8)], in accordance with a previous study [18]. The daily THI data are presented in Fig. 1.

jast-64-6-1046-g1
Fig. 1. Temperature–humidity index during the experimental period from 27 June 2020 to 13 September 2020. Temperature–humidity index calculated as follows: THI= (1.8 × Tdb+32) – [(0.55 – 0.0055 × RH) × (1.8 × Tdb – 26.8)] (NRC [20]). The error bar means standard deviation. The red part means above THI 72, HS detected in cows. MAX: maximum THI; AVE: average THI; MIN: minimum THI.
Download Original Figure
Preparation of blood samples

Blood samples were collected from the jugular vein of each beef using 18-gauge needles at 08:00 h at 0, 3, 6, and 10 weeks. Serum tubes, K2 EDTA (K2E) 7.2 mg Plus tubes (BD Vacutainer, Franklin Lakes, NJ, USA), and sodium heparin (10 IU/mL) (BD Vacutainer) were prepared, and the collected blood samples were stored on ice before being transferred to the laboratory, except for heparin-treated blood samples, which were used to isolate peripheral blood mononuclear cells (PBMCs). Next, to separate the serum and plasma, the blood samples were centrifuged at 2,740×g for 15 min at 4°C. The serum and plasma were then transferred to a 1.5 mL tube and stored in a freezer (–80°C) before further analysis. The K2 EDTA blood samples were temporarily stored at 4°C for subsequent analysis.

Analyzing blood metabolites and amino acids

Analytical reagents for measuring blood urea nitrogen, glucose, total protein, albumin, globulin, and creatine phosphokinase levels were purchased from Fujifilm healthcare (Tokyo, Japan). All these parameters were analyzed using a biochemistry analyzer (Fuji Dri Chem 7000i, Fujifilm).

Blood AAs were performed as described in the AA analyzer manual (Sykam 433, Sykam, Eresing, Germany). Briefly, 200 µL of plasma was deproteinized with an equal volume of 10% (w/v) sulfosalicylic acid and incubated for 30 min at 4°C, then centrifuged at 20,800×g for 3 min at room temperature. The supernatant fluid was filtered using a 0.2 µm nylon filter. The AAs were measured photometrically at 570 nm. The run time for each sample was 130 min.

Isolation of peripheral blood mononuclear cells for RNA extraction

The isolation of PBMCs was performed with a minor modification to the previously described method [21]. Blood samples were stored at room temperature and transferred to the laboratory for blood separation and further analyses. For the isolation of PBMCs, the blood samples were processed within 8 h of the sample collection. Density gradient centrifugation was used to separate PBMCs from the whole blood. The whole blood was diluted 1:1 with 1 × phosphate-buffered saline (PBS; Hyclone, Laboratories, Logan, UT, USA) and layered gently over Histopaque-1077 (Sigma-Aldrich, St. Louis, MO, USA). All the PBMC isolation steps were performed at room temperature as per the manufacturer’s instructions. The isolated PBMCs were washed twice with 1 × PBS. TRIzol Reagent (Life Technologies, Seoul, Korea) was then added to the pellet of PBMCs, and it was stored at –80°C until RNA extraction.

Collection of hair follicles for RNA extraction

The collection of hair follicles was performed according to the previously described method [22]. Tail hair (25 to 30 hairs) was pulled from each steer at 08:00 h. Individual hairs were grasped as close to the skin as possible and then rapidly pulled out. The hair follicles were washed using diethylpyrocarbonate (DEPC)-treated water. After the follicles were washed, the bottom centimeter of each hair, containing the hair follicle, was cut, and placed in a 5 mL specimen jar filled with RNAlater™ (Ambion, Austin, TX, USA). The samples were stored at room temperature for 1 to 14 days until RNA extraction. For RNA extraction, only the hair follicle was cut and placed in 1 mL of TRIzol, then finely ground with a homogenizer.

Longissimus dorsi muscle sampling and analysis

Longissimus dorsi muscle sampling and total RNA extraction were performed by surgical biopsy according to previously described methods minor modifications [23]. Tissue samples (approximately 2 g) were collected from the longissimus dorsi muscles of the steers (n = 8) via biopsy at week 10 of the experiment. The biopsy procedure followed the Konkuk University “Guidelines for the Care and Use of Experimental Animals”. Briefly, local anesthetic agents were administered at 6 equidistant points around the resection area, namely, the longissimus dorsi muscle at positions 12 to 13 of the ribs. The veterinarian resected 5 cm of skin in the direction of the muscle and then dissected the longissimus dorsi muscle tissue using surgical equipment. The collected tissue was immediately washed with DEPC-treated distilled water (diethylpyrocarbonate, Sigma-Aldrich, Seoul, Korea), placed in liquid nitrogen until completely frozen, and placed on dry ice until transferal to the laboratory. The tissue samples were then ground into powder in liquid nitrogen. Total RNA was extracted using TRIzol Reagent. An amount of 0.1 g of tissue sample was mixed with 1 mL of TRIzol. Next, the sample was homogenized using a homogenizer (IKA T10 basic, IKA, Seoul, Korea). The muscle tissue was stored at –80°C until RNA extraction.

Total RNA extraction

The method used for extracting total RNA from the PBMCs, hair follicles, and muscle tissue were the same. The samples were centrifuged at 4°C and 12,000×g for 10 min; then, the upper aqueous phase was transferred into a new 1.5 mL tube. Next, 200 μL of chloroform was added, and the mixture was incubated for 2 min at room temperature after vortexing, followed by centrifugation at 12,000×g for 15 min at 4°C. The upper transparent aqueous phase was transferred into a new 1.5 mL tube. Isopropanol (500 μL) was added, and the sample was incubated for 10 min at room temperature after vortexing, followed by centrifugation at 12,000×g for 10 min at 4°C to precipitate the RNA. The supernatant was then discarded, and the RNA was washed by adding 1 mL of 75% ethanol to the tube. After vortexing, the mixture was centrifuged at 4°C and 12,000×g for 10 min. To collect the RNA, the wash step was repeated with 1 mL of 100% ethanol following the same procedure. After washing, the extracted RNA was dried under a vacuum for approximately 15 min, redissolved in 30 μL of DEPC-treated distilled water, and then incubated at 60°C for 10 min. The RNA concentration was determined using spectrophotometric analysis (NanoDrop 1000, Thermo Scientific, Seoul, Korea).

Design of primers

In the muscle tissue, fatty acid–binding protein 4 (FABP4), glycerophosphate dehydrogenase (GDP), heat shock protein beta 1 (HSPB1, lipoprotein lipase (LPL), myoblast determination (MyoD), myogenic factor 5 (MYF5), myogenic factor 6 (MYF6), myogenin (MyoG), peroxisome proliferator-activated receptor-gamma (PPARγ), stearoyl-CoA desaturase (SCD), 18S ribosomal RNA (18S), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and ribosomal protein lateral stalk subunit P0 (RPLP0) primers were designed using the National Center for Biotechnology Information (NCBI) Primer-BLAST (Table 2). In the PBMCs, HSP70, HSP90, beta-2-microglobulin (B2M), and ribosomal protein S15a (RPS15A) primers were also designed using the NCBI Primer-BLAST (Table 2). In the hair follicle, we used HSP70, HSP90, and GAPDH designed above.

Table 2. Primer sequences used in qPCR assays
Gene symbol Gene name Annealing temperature Forward primer (5’ → 3’) Reverse primer (5’ → 3’)
FABP4 Fatty acid binding protein 4 60.8°C TGTCACTGCCACCAGAGTTT TGGACAACGTATCCAGCAGAA
GDP Glycerophosphate dehydrogenase 65.0°C CACGAAGTCCATCTCCCGAA GTTGTCCACTTTCCACCTGCT
LPL Lipoprotein lipase 60.0°C TACCCTGCCTGAAGTTTCCAC CCCAGTTTCAGCCAGACTTTC
PPARγ Peroxisome proliferator-activated receptor gamma 61.0°C ACTTTGGGATCAGCTCCGTG TCCTCATAGTGCGGAGTGGA
SCD Stearoyl-CoA desaturase 60.0°C TCCGACCTAAGAGCCGAGAA GCAGGATGAAGCACAACAACAG
HSPB1 Heat shock protein beta 1 60.0°C CCTGGACGTCAACCACTTC GCTTGCCAGTGATCTCCAC
MYOD Myoblast determination protein 59.6°C AGAGTTGCTTTGCCAGAG CTGCCTGCCGTATAAACA
MYF5 Myogenic factor 5 62.5°C TCCTGATGTACCAAATGTATATGCC ATCCAGGTTGCTCTGAGTTGG
MYF6 Myogenic factor 6 60.7°C GAAGGAGGGACAAGCATTGA GAGGAAATGCTGTCCACGAT
MYOG Myogenin 65.0°C TACAGACGCCCACAATCTGC GGTTTCATCTGGGAAGGCCG
HSP70 Heat shock protein 70 60.0°C TACGTGGCCTTCACCGATAC GTCGTTGATGACGCGGAAAG
HSP90 Heat shock protein 90 60.0°C GGAGGATCACTTGGCTGTCA GGGATTAGCTCCTCGCAGTT
18S 18S ribosomal RNA 51.0°C ACCCATTCGAACGTCTGCCCTATT TCCTTGGATTGTGGTAGCCGTTTCT
GAPDH Glyceraldehyde-3-phosphate dehydrogenase 60.0°C CGTGGAGGGACTTATGACCAC CGCCAGTAGAAGCAGGGATG
RPLP0 Ribosomal protein lateral stalk subunit P0 62.5°C CAACCCGGCTCTGGAGAAACTG ACTTCACACGGCGCTATGG
B2M beta-2-Microglobulin 60.0°C GACACCCACCAGAAGATGGA CAGGTCTGACTGCTCCGATT
RPS15A Ribosomal protein S15a 60.0°C CCGTGCTCCAAAGTCATCGT GGGAGCAGGTTATTCTGCCA

qPCR, quantitative polymerase chain reaction.

Download Excel Table
Synthesis of cDNA and gene expression analysis

To synthesize cDNA, 1 µg of RNA was reverse transcribed in a 100 μL reaction volume with an iScriptTM cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s protocol. Quantitative real-time polymerase chain reaction (qPCR) was performed on duplicate samples by using a CFX ConnectTM Real-Time System (Bio-Rad, Seoul, Korea) with IQTM SYBR Green Supermix reagents (Bio-Rad, Seoul, Korea). The following PCR conditions were used: 95°C for 3 min and 40 cycles at 95°C for 10 s, 51°C–65°C for 30 s and 72°C for 30 s. The threshold cycles for each sample were normalized to housekeeping genes (muscle tissue: RPLP0, GAPDH, 18S; PBMCs: B2M, RPS15A; hair follicle: GAPDH). The relative expression of the target gene was quantified as the fold change of the expression of the target gene relative to the expression of the thermoneutral control according to the 2-ΔΔrCT method [24].

Statistical analysis

Growth performance, complete blood cell count, blood metabolite, and blood AA were analyzed using SAS 9.4 Proc Mixed and repeated-measures analysis (SAS Institute, Cary, NC, USA). The model used was as follows:

Y i j k = μ + α i + γ ( α ) i j k + ε i j k

where Yijk is the observation of Hanwoo steers k at sampling time j for given treatment i; μ represents the overall mean, αi denotes the fixed effect of treatment i (control and Gln supplementation group); γ(α)ijk is the random effect of Hanwoo steers k nested in treatment i, and sampling time j (3, 6, 10 weeks, or every day); and εijk represents the residual effect. Covariance structures (autoregressive order 1 and unstructured) for the repeated measures model were tested. The structure that best fit the model was chosen based on the smallest value of Schwarz’s Bayesian information criterion. The first day of sampling in the adaptation period was included as a covariate to correct the means. The covariate factor was included in the model when appropriate but was removed from the model when it was insignificant. Data are presented as least square means and associated with standard errors.

Data of behavior, RT, and mRNA expression from each sample including muscle, PBMCs, and hair follicle, were assessed using independent (unpaired) sample t-tests for unequal variances. The model used was as follows:

Y i k = μ + β i + ε i k

where Yik represents the observation of Hanwoo steers k for given treatment i; μ is the overall mean; bi denotes the fixed effect of treatment i (control and Gln supplementation group); and εik is the residual effect.

Data of behavior, RT, and mRNA expression from the PBMCs and hair follicles were determined using the one-way ANOVA procedure with Tukey’s test. The model used was as follows:

Y i k = μ + δ i + ε i k

where Yik represents the observation of Hanwoo steers k for given sampling times i; μ is the overall mean; δi was the fixed effect of sampling times i (3, 6, and 10 weeks); and εik stands for the residual effect. Differences observed between means were considered significant at p < 0.05, and the tendency was declared at 0.05 ≤ p < 0.1.

RESULTS AND DISCUSSION

Effect of Gln supplementation on rectal temperature and behavior characteristics

For this study, which was conducted at the hottest time of the year in Korea, 17 July to 31 August, the animals were under HS conditions, as revealed by an average temperature of 26.2°C (range 24.3°C–28.9°C), a RH of 84.0% (range 69.6%–93.7%), and an average THI of 76.9 (range 73.1–80.2) (Fig. 1). The average THI for the entire experiment was 74.6, the average maximum THI was 80, and the average minimum THI was 69.9 (Fig. 1). In the ambient temperature 25°C and RH 45%–50% (THI 72.8–73.3) which is upper critical temperature because Bos taurus increased slightly the respirations but remained RT and heat production in the THI [25]. Furthermore, fattening cows have difficultly dissipating heat because their surface area relative to weight becomes smaller, increasing the insulation effect by increasing the body condition score [2].

Based on the studies mentioned above, in this experiment, the Hanwoo steers experienced sufficient HS, and the RT measurements are shown in Fig. 2B. In Fig. 2A, the mean THI, maximum THI, and minimum THI were identified at the measuring time for RT and behavior. The average THI was maintained at approximately 75.1 until 67 days after the start of the experiment, and the average THI decreased over time (Fig. 1). Thus, the average RT of 38.6°C at 10 weeks was 0.26°C lower than the average RT at 0, 3, and 6 weeks. The difference in RT resulting from Gln supplementation was not shown (p > 0.05).

jast-64-6-1046-g2
Fig. 2. Rectal temperature and behavior including standing and lying (10:00 to 18:00 h) during the experimental period at 0, 3, 6, 10 weeks. (A) Maximum THI and average THI, minimum THI of the day, measured RT and behavior. Temperature–humidity index calculated as follows: THI = (1.8 × Tdb+32) – [(0.55 – 0.0055 × RH) × (1.8 × Tdb – 26.8)] [20]. (B) The RT at 0, 3, 6, 10 weeks. Data are presented as the means ± standard error. □ control ■ treatment, error bar means standard error (n = 4) (p > 0.05). (C) Behavior including standing and lying in 0, 3, 6, 10 weeks (p > 0.05). RT, rectal temperature; RH, relative humidity.
Download Original Figure

Through looking at standing behavior time and lying behavior time, we could confirm whether there was a difference in behavior according to Gln supplementation. The average standing time in the control group was 426.3 min/480 min, and in the treatment group, it was 420.8 min/480 min (Fig. 2C). Lying time in the control group was 53.8 min/480 min, and in the treatment group, it was 59.2 min/480min (Fig. 2C). Although Gln supplementation resulted in no difference in behavior (p > 0.05), the standing time was approximately 7.5 times longer than the lying time (from 10:00 to 18:00 h). This long standing time results in an increase in surface area contact with outside air to reflect heat in HS [26,27]. Consistently, Pinto and Hoffmann [28] reported that a longer standing time increases the efficiency of respiration in cows.

Effect of L-glutamine supplementation on blood amino acids in Hanwoo steers

The tendency of L-citrulline and L-glutamic acid to increase compared with the control groups was confirmed by Gln supplementation under HS (p < 0.10). Blood glutamic acid (Glu) increased 2.27 times compared with the control group to show a concentration of 28.2 µmol/L (p = 0.083). Gln is transferred from the arterial blood to the inner cell. The Gln that enters the cell is converted into Glu by glutaminase, and Glu acts as an energy producer or intermediate, or is discharged into venous blood [29]. As a result, the amount of blood Glu increased in the 0.5% Gln supplemented group compared with the control group.

Blood L-citrulline increased 1.3 times compared with the control group to show a concentration of 30.2 µmol/L (p = 0.061). According to a previous study, approximately 6% of the carbon is used to form L-citrulline through Gln metabolism, and 34% of the nitrogen from Gln is used to produce L-citrulline [30]. Moreover, cyclical L-citrulline increases as the clearance of L-citrulline is reduced because Gln and L-citrulline share transporters [31].

Effect of L-glutamine supplementation on blood metabolite profile in Hanwoo steers

HS reduced the feed intake but increased the maintenance energy requirement for sweating and panting to reduce body temperature [3]. Gln could be a respiratory fuel in immune cells, muscles, the liver, and digestive organs [13]. As Gln was used as energy, it was able to increase blood glucose by reducing the amount of use of blood glucose; however, there was no difference between the two groups (Table 3, p = 0.104). When multiparous Holstein cow duodenums were infused with Gln 300g/day, which amount of Gln was a higher amount of Gln than in this study, there were no differences in energy metabolisms such as glucose, non-esterified fatty acids, and beta-hydroxybutyrate [32].

Table 3. Effect of 0.5% L-glutamine supplementation on blood amino acid concentration in Hanwoo steers
Items (µmol/L) Control Treatment SEM p-value
Ammonium chloride 50.9 46.8 3.44 0.278
Glycine 62.1 65.5 3.88 0.410
L-Alanine 48.8 52.6 4.05 0.378
L-Arginine 22.7 26.0 1.84 0.123
L-Citrulline 23.3 30.2 3.01 0.061
L-Glutamic acid 12.4 28.2 7.58 0.083
L-Histidine 11.7 11.5 1.21 0.896
L-Isoleucine 24.0 26.4 2.86 0.421
L-Leucine 36.6 43.1 5.00 0.244
L-Lysine 37.1 37.7 8.72 0.944
L-Methionine 6.3 5.5 0.66 0.302
L-Ornithine-monohydrochloride 21.4 24.6 3.45 0.391
L-Phenylalanine 23.8 21.1 1.44 0.104
L-Tryptophan 6.3 7.7 0.76 0.132
L-Tyrosine 19.6 19.2 2.07 0.840
L-Valine 56.8 65.5 8.30 0.338
Taurine 12.0 14.4 1.93 0.256
Download Excel Table

There was no difference in the amount of blood urea nitrogen (p = 0.837) and creatine phosphokinase (p = 0.684) according to Gln supplementation. Previous studies have confirmed the increase in blood urea nitrogen due to Gln treatment. This study supplied Gln at approximately 51.45 g per day, which is less than Gln 300 g per day in previous studies [32,33].

Gln supplementation tended to reduce total protein in the blood (p = 0.097) and albumin (p = 0.059). The total protein decreased due to the decrease in albumin. Albumin has various functions, such as regulating the plasma oncotic pressure and transporting nutrients. Contrary to this study, a previous study found that albumin was increased as the formalin-treated Gln was increased by 150, 250, and 350 g per day [34]. Moreover, the intake of Gln increases albumin in situations where albumin reduced due to surgery [35]. Albumin concentrations decrease as albumin escapes into the urine as a result of renal difficulties, or or as albumin synthesis decreases due to liver disorders [36]. However, given the albumin concentrations in this study are within the normal range of 2.73 to 3.65 g/dL, they were not altered by renal or liver disorders [37]. The results of this experiment need further research to identify the effect of different ratios of Gln infusion or supplementation on blood metabolites and to warrant the obtained results.

Effect of L-glutamine supplementation on growth performances in Hanwoo steers

To the best of our knowledge, there have been no experiments to confirm growth performances as a result of the addition of Gln to cows. Until now, there have been studies that provided Gln to cows to boost the immune system and milk production [32,34]. Even though there have been no previous studies on an improvement in growth performance with the addition of Gln in cows, it was confirmed that growth performance, with the addition of Gln, was improved under HS conditions in broilers [38,39]. We supplied Gln at 0.5% of the total diet (as-fed basis) for 9 weeks under HS conditions, but we observed no difference in feed intake, average daily gain, final BW, or gain-to-feed ratio (p > 0.05). The reason why there were no differences in growth performances could be explained by the following two speculations. First, the addition of 0.5% Gln in the presence of HS may be considered insufficient to indicate a change in growth performance. Second, because the purpose of this study was to focus on physiological phenomena during HS conditions, the experiment period was relatively short (10 weeks). A longer experiment period may result in the observation of significant changes in growth performance parameters, and this could be a hypothesis for further research. It is suggested that various amounts of Gln be supplied to cattle during HS to observe the possible positive effect on performance; however, the amount of supplementation should be limited to an amount of Gln lower than 2% of the total diet, due to possible toxic effects. This is because, if Gln supplementation exceeds 2% of the total diet, the ammonia concentration in rumen fluid exceeds the normal range [16].

Effect of L-glutamine supplementation on complete blood cell counts in Hanwoo steers

Gln supplementation increased the number of white blood cell (WBC) by 1.26 times (p = 0.058), lymphocytes by 1.30 times (p = 0.068), and granulocytes by 1.28 times (p = 0.031), but the proportion decreased as it did not affect the number of monocytes (p = 0.058) (Table 4). HS reduced bovine lymphocyte proliferation because HS may impair the T helper cell 1 and T helper cell 2 balance [40]. However, Gln supplementation increased the lymphocyte and granulocyte under HS conditions. The first reason for this could be that Gln is utilized as energy sources for immune cells, especially lymphocytes [15]. The second reason could be that Gln can convert a substrate for nucleotide synthesis [14]. Finally, Gln stimulates cytokines including interferon γgene expression in the hair follicle was, Interleukin 2, interleukin 4, and interleukin 10, for direct or indirect lymphocyte proliferation [14].

Table 4. Effect of 0.5% L-glutamine supplementation on haematological parameters in Hanwoo steers
Items Control Treatment SEM p-value
Leukocyte indices
 WBC (103/µL) 10.20 12.88 1.15 0.058
 LYM (103/µL) 5.78 7.51 0.78 0.068
 GRA (103/µL) 3.96 5.07 0.40 0.031
 MON (103/µL) 0.45 0.31 0.21 0.520
 LYM (%/WBC) 57.19 58.06 2.50 0.740
 GRA (%/WBC) 38.59 39.71 2.31 0.644
 MON (%/WBC) 4.53 2.33 0.94 0.058
Erythrocyte indices
 RBC (106/µL) 9.93 8.84 0.73 0.185
 HGB (g/dL) 14.24 13.56 0.64 0.328
 HCT (%) 40.01 38.06 1.86 0.334
 MCH (pg) 14.41 15.42 0.68 0.188
 MCHC (g/dL) 35.64 35.63 0.56 0.988
 MCV (fL) 40.26 43.15 2.01 0.200
 RDW (%) 21.75 20.48 0.63 0.090
Platelet indices
 PLT (103/µL) 352.35 310.92 60.84 0.521
 PCT (%) 0.25 0.22 0.05 0.600
 MPV (fL) 6.85 7.15 0.24 0.259
 PDW (%) 33.25 33.07 1.19 0.888

WBC, white blood cell; LYM, lymphocyte; GRA, granulocyte; MON, monocyte; RBC, red blood cell; HGB, hemoglobin; HCT, hematocrit; MCV, mean corpuscular volume; MCHC, mean corpuscular hemoglobin concentration; MCH, mean corpuscular hemoglobin; RDW, red blood cell width; PLT, platelet; MPV, mean platelet volume; PCT, plateletcrit; PDW, platelet distribution width.

Download Excel Table

In addition, there were no differences in erythrocyte instruments and platelet instruments between the two groups (Table 5, p > 0.05).

Table 5. Effect of 0.5% L-glutamine supplementation on biochemical parameters in Hanwoo steers
Items Control Treatment SEM p-value
Blood urea nitrogen (mg/dL) 18.21 17.84 1.68 0.837
Glucose (mg/dL) 71.88 66.68 2.71 0.104
Total protein (g/dL) 7.50 7.12 0.19 0.097
Albumin (g/dL) 3.43 3.25 0.08 0.059
Globulin (g/dL) 4.06 3.84 0.14 0.146
A/G ratio 0.84 0.86 0.04 0.616
Creatine phosphokinase (µ/L) 111.50 121.50 23.41 0.684
Download Excel Table
Table 6. Effect of 0.5% L-glutamine supplementation on growth performance in Hanwoo steers
Items Control Treatment SEM p-value
0 weeks
 Average body weight 571.8 569.6 23.5 0.950
3 weeks
 Average body weight 578.0 579.5 22.8 0.964
 Increment 6.25 9.94 3.82 0.537
 Average daily gain 0.30 0.47 0.18 0.533
 Feed intake 9.39 9.89 0.55 0.539
 Gain-to-feed ratio 0.03 0.05 0.03 0.354
6 weeks
 Average body weight 584.5 591.1 25.2 0.859
 Increment 6.50 11.6 3.90 0.388
 Average daily gain 0.31 0.55 0.19 0.388
 Feed intake 9.21 9.48 0.16 0.182
 Gain-to-feed ratio 0.03 0.06 0.02 0.360
10 weeks
 Average body weight 610.5 618.4 22.1 0.809
 Increment 26.0 27.3 4.92 0.863
 Average daily gain 0.90 0.94 0.17 0.863
 Feed intake 9.40 9.47 0.19 0.738
 Gain-to-feed ratio 0.10 0.10 0.02 1.000
Total
 Increment body weight 12.9 16.3 3.71 0.395
 Average daily gain 0.50 0.66 0.17 0.383
 Feed intake 9.35 9.61 0.41 0.671
 Gain-to-feed ratio 0.06 0.07 0.02 0.476
Download Excel Table
Effect of L-glutamine supplementation on heat shock protein gene expression in the hair follicle and peripheral blood mononuclear cells of Hanwoo steers

At the cellular level, all animals respond to HS by synthesizing HSPs, which protect cells from heat-induced injury. HSP70 and HSP90 are molecular chaperones that protect cells from HS by refolding denatured proteins back into their correct conformations [41]. There were no differences in HSP70 and HSP90 expressions in PBMCs between the groups (p > 0.05, Figs. 3A and 3B). Only HSP70 tended to change in the control group according to the sampling weeks (p = 0.093, Fig. 2A).

jast-64-6-1046-g3
Fig. 3. Heat shock protein 70 and 90 gene expression on peripheral blood mononuclear cells (PBMCs) and hair follicles in Hanwoo steers from the control group and L-glutamine supplementation group. (A) Validation by qPCR of HSP70 gene in PBMCs. (B) Validation by qPCR of HSP90 gene in PBMCs. (A,B) qPCR values are shown as the fold change in expression after normalization to the control genes at week 0 RPS15A and B2M. (C) Validation by qPCR of HSP70 gene in the hair follicle. (D) Validation by qPCR of HSP90 gene in the hair follicle. (C,D) qPCR values are shown as the fold change in expression after normalization to the control genes at week 0 GAPDH. □ Control group (n = 4), ■ Treatment group (n = 4). Data are presented as the means ± standard error. a,bMeans with different superscripts differ significantly in the control group (p < 0.05) among the sampling weeks. A,B Means with different superscripts differ significantly in the treatment group (p < 0.05). *Means with different superscripts differ significantly between groups (p < 0.01). qPCR, quantitative polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Download Original Figure

HSP70 and HSP90 gene expression were changed according to sampling weeks except HSP70 in the treatment group (p < 0.05, Figs. 3C and 3D). HSP90 gene expression in the hair follicle was decreased in the treatment group at 10 weeks (p < 0.01). The expression of HSP70 and HSP90 in the hair follicle is among the indicators of HS responses [22]. In the treatment group (0.5% Gln), the expression of these two HSPs was less than in the control group, meaning that Gln had a positive effect on the reduction in HS in 10 weeks. Thus, supplementation with Gln at 0.5% may attenuate HS at 10 weeks.

Effect of L-glutamine supplementation on gene expression related to myogenesis and adipogenesis, lipogenesis, and lipolysis in longissimus dorsi muscle tissue of Hanwoo steers

There were no differences between the groups in gene expression related to muscle tissue, including HSPB1, MyoD, MYF5, MYF6, and MyoG, and gene expression related to fat tissue, including FABP4, GDP, LPL, PPARγ, and SCD (Fig. 4, p > 0.05). Gln is known to be related to the development of muscle cells, such as the role of respiratory fuel in muscle cells, the synthesis of proteins of myosin heavy chain, and precursors for nucleotide [13]. Moreover, Gln reduced the HS in cells by increasing the gene expression of HSPB1 in bovine embryonic fibroblast cell [11]. As Gln was added by 0, 1, 2, and 4 mM, the expression of HSPB1 was linearly increased [11]. HSPB1-increased gene expression related to the differentiation of myocytes including MyoG and Desmin, and the increased cellular protein of myocytes [11]. Therefore, it could be expected that the expression of muscle development-related genes would sufficiently increase by the above functions of Gln under HS; however, there was no difference between the two groups in the current study (p > 0.05). The reasons could be speculated as follows. First, the supplementation of Gln was used in immune cells rather than muscle cells. The increase in immune cells, which is an essential factor for survival, is more important than muscle development. Second, as the amount of Gln stored varies depending on the muscle type, the reaction may differ depending on the Gln supplementation. Type I muscle fibers have approximately three times more Gln storage that type II fibers [12]. Type I muscle fibers have a higher activity of Gln synthetase and higher availability of ATP for Gln synthesis [12]. In the case of longissimus dorsi muscle sampled in this study, the number of type I muscle fiber was approximately 33.1%, and the area of type I muscle fiber was approximately 24.3% of muscle fiber in Hanwoo steers [42]. The amount of Gln in the longissimus dorsi muscle was higher than for round and chuck [43]. Thus, additional Gln treatment may be less effective because the longissimus dorsi muscle already stores a lot of Gln. Furthermore, we need to confirm the effect of Gln supplementation on muscle development according to the parts of muscle or the type of muscle fiber in cows.

jast-64-6-1046-g4
Fig. 4. Gene expression study in Hanwoo steer longissimus dorsi muscles from the control group and L-glutamine supplementation group. Validation by qPCR of 13 genes in longissimus dorsi muscles. The qPCR values are shown as the fold change in expression after normalization to the control genes 18S, GAPDH, and RPLP0. □ Control group (n = 4), ■ Treatment group (n = 4). Data are presented as the means ± standard error. p > 0.05. qPCR, quantitative polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RPLP0, ribosomal protein lateral stalk subunit P0; FABP4, fatty acid-binding protein 4; GDP, glycerophosphate dehydrogenase; LPL, lipoprotein lipase; PPARγ, peroxisome proliferator-activated receptor-gamma; SCD, stearoyl-CoA desaturase; HSPB1, heat shock protein beta 1; MyoD, myoblast determination; MYF5, myogenic factor 5; MYF6, myogenic factor 6; MyoG, myogeni.
Download Original Figure

It was important to analyze the gene expression related to adipose developments in the longissimus dorsi muscle because this part of the muscle has interaction between muscle tissue, intra-, and intermuscular fat tissue. Carbone sourced from Gln was synthesized to fatty acid in adipocyte. Gln stimulated the gene expression of fatty acid synthase and GPD [13]. However, there was no difference between the control and supplementation groups for FABP4, GDP, LPL, PPARγ, SCD, HSPB1, MyoD, MYF5, MyF6, and MyoG in this study.

CONCLUSION

Short-term supplementation with Gln at 0.5% of the total diet (as-fed basis) stimulated lymphocyte and granulocyte proliferation despite the HS that caused immune system decline. Despite no differences in physiological and behavioral characteristics between the control and Gln supplementation group, our results indicated that HSP90 was more resistant to HS in the Gln supplementation group. Gln may prioritize immune improvement under HS condition as shown in this study by boosting immune parameters, including granulocyte, lymphocyte, monocyte, and WBC. Thus, supplementation with 0.5% Gln could be beneficial in improving the immune system in beef cattle under HS conditions. Further study is needed to examine whether muscle development improves when higher concentrations of Gln are added for longer periods.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This work was supported by Korean Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Export Promotion Technology Development Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (grant number 618002-05) and Konkuk University Researcher Fund in 2021.

Acknowledgements

This work was supported by Korean Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Export Promotion Technology Development Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (grant number 618002-05) and Konkuk University Researcher Fund in 2021.

Availability of data and material

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Authors’ contributions

Conceptualization and hypothesis: Kamali Y, Jo YH, Lee HG.

Data curation: Kamali Y, Jo YH.

Formal analysis: Ghassemi Nejad J, Lee JS.

Methodology: Kamali Y, Jo YH, Kim WS, Lee JS.

Investigation: Kim WS, Ghassemi Nejad J, Lee JS.

Writing - original draft: Kamali Y, Jo YH.

Writing - review & editing: Kamali Y, Jo YH, Kim WS, Ghassemi Nejad J, Lee JS, Lee HG.

Ethics approval and consent to participate

This article does not contain any studies with human subjects performed by any of the authors.All experimental procedures were followed according to the Konkuk University “Guidelines for the Care and Use of Experimental Animals” (Approval no: KU20001).

REFERENCES

1.

Korea Meteorological Administration. Climate information portal [Internet]. 2021[cited 2022 May 1]http://www.climate.go.kr

2.

National Academies of Sciences, Engineering, and Medicine. Nutrient requirements of beef cattle. 8th ed Washington, DC: National Academy Press. 2016

3.

Wheelock JB, Rhoads RP, VanBaale MJ, Sanders SR, Baumgard LH. Effects of heat stress on energetic metabolism in lactating Holstein cows. J Dairy Sci. 2010; 93:644-55

4.

Cowley FC, Barber DG, Houlihan AV, Poppi DP. Immediate and residual effects of heat stress and restricted intake on milk protein and casein composition and energy metabolism. J Dairy Sci. 2015; 98:2356-68

5.

McGuire MA, Beede DK, DeLorenzo MA, Wilcox CJ, Huntington GB, Reynolds CK, et al. Effects of thermal stress and level of feed intake on portal plasma flow and net fluxes of metabolites in lactating Holstein cows. J Anim Sci. 1989; 67:1050-60

6.

Clark JH, Klusmeyer TH, Cameron MR. Microbial protein synthesis and flows of nitrogen fractions to the duodenum of dairy cows. J Dairy Sci. 1992; 75:2304-23

7.

Bernabucci U, Calamari L. Effects of heat stress on bovine milk yield and composition. Zootec Nutr Anim. 1998; 24:247-57

8.

Mishra A, Hooda OK, Singh G, Meur SK. Influence of induced heat stress on HSP70 in buffalo lymphocytes. J Anim Physiol Anim Nutr. 2011; 95:540-4

9.

Gao ST, Guo J, Quan SY, Nan XM, Sanz Fernandez MV, Baumgard LH, et al. The effects of heat stress on protein metabolism in lactating Holstein cows. J Dairy Sci. 2017; 100:5040-9

10.

Tyrrell HF, Reynolds PJ, Moe PW. Effect of diet on partial efficiency of acetate use for body tissue synthesis by mature cattle. J Anim Sci. 1979; 48:598-606

11.

Kim YS, Lee JS, Lee Y, Kim WS, Peng DQ, Bae MH, et al. Effect of glutamine on heat-shock protein beta 1 (HSPB1) expression during myogenic differentiation in bovine embryonic fibroblast cells. Food Sci Biotechnol. 2018; 27:829-35

12.

Tirapegui J, Cruzat VF. Glutamine and skeletal muscle.In: In: Rajendram R, Preedy VR, Patel VB, editors.editors. Glutamine in clinical nutrition. New York, NY: Humana Press. 2015; p p. 499-511

13.

Curi R, Lagranha CJ, Doi SQ, Sellitti DF, Procopio J, Pithon‐Curi TC, et al. Molecular mechanisms of glutamine action. J Cell Physiol. 2005; 204:392-401

14.

Chang WK, Yang KD, Shaio MF. Effect of glutamine on Th1 and Th2 cytokine responses of human peripheral blood mononuclear cells. Clin Immunol. 1999; 93:294-301

15.

Ardawi MSM, Newsholme EA. Maximum activities of some enzymes of glycolysis, the tricarboxylic acid cycle and ketone-body and glutamine utilization pathways in lymphocytes of the rat. Biochem J. 1982; 208:743-8

16.

Suh JK, Nejad JG, Lee YS, Kong HS, Lee JS, Lee HG. Effects of L-glutamine supplementation on degradation rate and rumen fermentation characteristics in vitro. Anim Biosci. 2022; 35:422-33

17.

Korea Meteorological Administration. Korean climate change assessment report. Seoul: Korea Meteorological Administration. 2020Report No.: 11-1360000-001657-01

18.

National Research Council. Nutrient requirements of dairy cattle. 7th ed Washington, DC: National Academy Press. 2001

19.

National Research Council. Nutrient requirements of dairy cattle. 6th ed Washington, DC: National Academy Press. 1989

20.

National Research Council. A guide to environmental research on animals. Washington, DC: National Academy of Sciences. 1971

21.

Kim WS, Ghassemi Nejad J, Roh SG, Lee HG. Heat-shock proteins gene expression in peripheral blood mononuclear cells as an indicator of heat stress in beef calves. Animals. 2020; 10:895

22.

Kim WS, Ghassemi Nejad J, Peng DQ, Jung US, Kim MJ, Jo YH, et al. Identification of heat shock protein gene expression in hair follicles as a novel indicator of heat stress in beef calves. Animal. 2020; 14:1502-9

23.

Priatno W, Jo YH, Nejad JG, Lee JS, Moon JO, Lee HG. “Dietary supplementation of L-tryptophan” increases muscle development, adipose tissue catabolism and fatty acid transportation in the muscles of Hanwoo steers. J Anim Sci Technol. 2020; 62:595-604

24.

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001; 25:402-8

25.

Hashizume T, Kato M, Haryu T, Tatsumi H, Masubuchi T, Hatano M. Studies of energy metabolism in cattle 3. Influence of temperature on resting metabolism of Japanese black cattle. Bull Natl Inst Anim Ind. 1966; 11:39-47

26.

Kim WS, Lee JS, Jeon SW, Peng DQ, Kim YS, Bae MH, et al. Correlation between blood, physiological and behavioral parameters in beef calves under heat stress. Asian-Australas J Anim Sci. 2018; 31:919-25

27.

Allen JD, Hall LW, Collier RJ, Smith JF. Effect of core body temperature, time of day, and climate conditions on behavioral patterns of lactating dairy cows experiencing mild to moderate heat stress. J Dairy Sci. 2015; 98:118-27

28.

Pinto S, Hoffmann G, Ammon C, Amon B, Heuwieser W, Halachmi I, et al. Influence of barn climate, body postures and milk yield on the respiration rate of dairy cows. Ann Anim Sci. 2019; 19:469-81

29.

Dutta S, Ray S, Nagarajan K. Glutamic acid as anticancer agent: an overview. Saudi Pharm J. 2013; 21:337-43

30.

Wijnands KAP, Castermans TMR, Hommen MPJ, Meesters DM, Poeze M. Arginine and citrulline and the immune response in sepsis. Nutrients. 2015; 7:1426-63

31.

Marini JC. Interrelationships between glutamine and citrulline metabolism. Curr Opin Clin Nutr Metab Care. 2016; 19:62-6

32.

Doepel L, Lessard M, Gagnon N, Lobley GE, Bernier JF, Dubreuil P, et al. Effect of postruminal glutamine supplementation on immune response and milk production in dairy cows. J Dairy Sci. 2006; 89:3107-21

33.

Doepel L, Lobley GE, Bernier JF, Dubreuil P, Lapierre H. Effect of glutamine supplementation on splanchnic metabolism in lactating dairy cows. J Dairy Sci. 2007; 90:4325-33

34.

Nemati M, Menatian S, Ghasemi SJ, Hooshmandfar R, Taheri M, Saifi T. Effect of protected-glutamine supplementation on performance, milk composition and some blood metabolites in fresh Holstein cows. Iran J Vet Res. 2018; 19:225-8

35.

Wu JM, Ho TW, Lai IR, Chen CN, Lin MT. Parenteral glutamine supplementation improves serum albumin values in surgical cancer patients. Clin Nutr. 2021; 40:645-50

36.

Friedman AN, Fadem SZ. Reassessment of albumin as a nutritional marker in kidney disease. J Am Soc Nephrol. 2010; 21:223-30

37.

Alberghina D, Giannetto C, Vazzana I, Ferrantelli V, Piccione G. Reference intervals for total protein concentration, serum protein fractions, and albumin/globulin ratios in clinically healthy dairy cows. J Vet Diagn Invest. 2011; 23:111-4

38.

Dai SF, Wang LK, Wen AY, Wang LX, Jin GM. Dietary glutamine supplementation improves growth performance, meat quality and colour stability of broilers under heat stress. Br Poult Sci. 2009; 50:333-40

39.

Soltan MA. Influence of dietary glutamine supplementation on growth performance, small intestinal morphology, immune response and some blood parameters of broiler chickens. Int J Poult Sci. 2009; 8:60-8

40.

Bagath M, Krishnan G, Devaraj C, Rashamol VP, Pragna P, Lees AM, et al. The impact of heat stress on the immune system in dairy cattle: a review. Res Vet Sci. 2019; 126:94-102

41.

Collier RJ, Collier JL, Rhoads RP, Baumgard LH. Invited review: genes involved in the bovine heat stress response. J Dairy Sci. 2008; 91:445-54

42.

Hwang YH, Kim GD, Jeong JY, Hur SJ, Joo ST. The relationship between muscle fiber characteristics and meat quality traits of highly marbled Hanwoo (Korean native cattle) steers. Meat Sci. 2010; 86:456-61

43.

Wu G, Cross HR, Gehring KB, Savell JW, Arnold AN, McNeill SH. Composition of free and peptide-bound amino acids in beef chuck, loin, and round cuts. J Anim Sci. 2016; 94:2603-13

PDF Download
PubReader
Export Citation
Email the Author

Metrics

View
12,764
Download
3,584
Crossref
6
Scopus
6

QR Code of this Article:



Related Articles




Revised Publication Charge


(Effective for articles submitted beginning January 1, 2026)

The publication charge is 1,500,000 Korean Won per article for members of the Korean Society of Animal Science and Technology (KSAST), and 2,000,000 Korean Won for non-members. First and corresponding authors are required to pay the annual membership fee.

The publication charge for a corresponding author outside Korea is 1,500 US dollars per article.


I don't want to open this window for a day.