RESEARCH ARTICLE

Effects of pollen patties with curcumin-steviol glycoside complex on Apis mellifera

Sehyun Park1,#https://orcid.org/0000-0002-6253-9496, Jihwan Lee2,#https://orcid.org/0000-0001-8161-4853, Gyutae Park1,#https://orcid.org/0000-0003-1614-1097, Dongcheol Song1https://orcid.org/0000-0002-5704-603X, Seyeon Chang1https://orcid.org/0000-0002-5238-2982, Jaewoo An1https://orcid.org/0000-0002-5602-5499, Kyeongho Jeon1https://orcid.org/0000-0003-2321-3319, Hyuck Kim1https://orcid.org/0000-0002-5280-0734, Youngho Lim1https://orcid.org/0000-0002-0238-4736, Jaeyoung Kim1https://orcid.org/0000-0002-2847-1731, Kisu Ahn3,*https://orcid.org/0009-0007-7748-8349, Jungseok Choi1,*https://orcid.org/0000-0001-8033-0410, Jinho Cho1,*https://orcid.org/0000-0001-7151-0778
Author Information & Copyright
1Department of Animal Science, Chungbuk National University, Cheongju 28644, Korea
2Department of Poultry Science, University of Georgia (UGA), Athens, GA 30602, United States
3Chungcheongbuk-do Research and Extension Services, Cheongju 28130, Korea

# These authors contributed equally to this work.

*Corresponding author: Jungseok Choi, Department of Animal Science, Chungbuk National University, Cheongju 28644, Korea, Tel: +82-43-261-2551, E-mail: jchoi@chungbuk.ac.kr
*Corresponding author: Jinho Cho, Department of Animal Science, Chungbuk National University, Cheongju 28644, Korea, Tel: +82-43-261-2544, E-mail: jinhcho@chungbuk.ac.kr

© Copyright 2025 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Nov 22, 2023; Revised: Jan 11, 2024; Accepted: Jan 29, 2024

Published Online: Mar 31, 2025

Abstract

The main objective of this study was to investigate the effects of pollen patty with supplementation of different concentrations of curcumin-steviol glycoside complex (CSG) in Apis mellifera (A. mellifera). Twelve colonies of A. mellifera were conducted from July 10th to August 21st for 42 days. A. mellifera were assigned to four dietary treatments with 3 replicates of equal size as follows: no supplementation of pollen patty (NC), supplementation of basal pollen patty (PC), supplementation of basal pollen diets + 0.04% of CSG (T1), supplementation of basal pollen diets + 0.08% of CSG (T2). The percentage of CSG was calculated based on the total weight of pollen patties. Thorax weight was significantly increased (p < 0.05) in the T2 diet compared with the NC and PC diet. There was no significant difference (p > 0.05) in pollen patties consumption among the PC, T1, and T2 diets. The T1 and T2 diets showed significantly higher (p < 0.05) honey production than the PC and NC diets. Also, the PC diet showed significantly higher (p < 0.05) honey production than the NC diet. The T2 showed significantly higher (p < 0.05) brood area than the PC and NC diets at 28 and 42 days. In addition, the PC and T1 diets showed significantly higher (p < 0.05) brood areas than the NC diet. The T1 and T2 diets showed significantly higher (p < 0.05) catalase and superoxide dismutase (SOD) 1 gene expression than the PC and NC diets. The expression of the thioredoxin reductase (Trxr) 1 gene was significantly higher (p < 0.05) in the T1 diet, and decreased in the order of the PC, T2, and NC diets. The expression of the SOD2 gene was significantly higher (p < 0.05) in the T1 diet than the PC and T2 diets and was significantly lower (p < 0.05) in the NC diet. Therefore, supplementation of CSG to pollen patty might be the ideal strategy to improve A. mellifera performances.

Keywords: Apis mellifera; Curcumin-steviol glycoside complex; Pollen patty

INTRODUCTION

Pollen-supplementary diets play a major role in honeybee health and honey production. Supply of artificial pollen diets to honeybee colonies is necessary for the development of young bee brood rearing, reproduction and maintenance of bee colonies, and honeybee production [13]. In cases of insufficient pollen supply, the immune system of bees and their strength weaken, which directly increases their mortality rate from attacks by various bee pests and pathogens [46]. Thus, most beekeepers feed honeybee colonies with pollen supplements such as defatted soybean, maize, and gram flour, especially when the natural pollen is not sufficient to maintain colony health and immunity in June-July [3,7,8]. Also, beekeepers supply artificially synthesized food known as pollen patties to increase food storage and nutrition in the winter season [9]. Therefore, several researchers have formulated and tested various artificial pollen diets to supply sufficient nutrients to maintain bee colonies [1012].

Pollen patties, which contain bee-collected pollen, are mixed with different ingredients to meet the desired nutrient requirement [13]. Supplements contain bee-collected pollen mixed with other ingredients, such as soybean flour and honey, to form the desired patty consistency [14]. Therefore, numerous studies have evaluated the effects of supplying pollen patties and identifying new materials for improving honeybee performance and honey production [4,–12].

Curcumin, which is produced by Curcuma longa L., is a natural phenol that promotes therapeutic properties such as anti-inflammatory, anticarcinogenic, and antioxidant activities [1517]. Also, curcumin has been shown to be a bifunctional antioxidant that scavenges reactive oxygen species (ROS) and triggers an antioxidant response to exert antioxidant activity both directly and indirectly [18,19]. However, curcumin possesses low absorption due to its impaired water solubility, unstable chemical structure, and rapid metabolism in the body [20,21]. To improve the bioavailability of curcumin, steviol glycosides have been used to increase the solubility by utilizing the solubilizing properties [22]. Steviol glycosides are substances extracted from stevia (Stevia rebaudiana Bertoni) leaves that have been reported to improve solubility by dissolving soluble substances [23,24]. Thus, the supplementation of pollen patties with a curcumin-steviol glycoside complex (CSG) could be an ideal strategy to increase immune systems and alleviate the adverse effects of bacteria and pathogens.

Therefore, the main objective of this study was to investigate the effects of pollen patty with supplementation of different concentrations of CSG on body weight, diet consumption, honey production, brood area measurement, and antioxidant gene expression.

MATERIALS AND METHODS

Experimental colonies with pollen patty diets

Twelve colonies of A. mellifera were conducted from July 10th to August 21st for 42 days at Chungbuk National University (36˚37’48" N, 12727’5” E) in Cheongju-si, Republic of Korea. The formulation of pollen patties is shown in Table 1. The CSG used in this experiment was obtained from a commercial company (BIOTEN, Jeongeup, Korea). A. mellifera were assigned to four dietary treatments with 3 replicates of equal size as follows: no supplementation of pollen patty (NC), supplementation of basal pollen patty (PC) supplementation of basal pollen diets + 0.04% of CSG [T1], supplementation of basal pollen diets + 0.08% of CSG (T2). The percentage of CSG was calculated based on the total weight of pollen patties. Each of the four groups consisted of 1 populated frame and 3 brood frames. Pollen patty diets were directly placed over the brood nests of bee colonies and covered with plastic sheets to prevent drying. They were freely and easily available to the A. mellifera colonies. The consumption of pollen patties was checked every day, and new pollen patties (300 g) were supplied every week.

Table 1. Composition and chemical analysis of basal pollen patties with curcumin-steviol glycoside complex (CSG)
Items PC1) T1 T2
Ingredients (g) 200 200 200
 Defatted soy flour 30 30 30
 Brewer’s yeast 15 15 15
 Pollen 15 15 15
 Sugar 40 32 24
 CSG 0 8 16
 Sugar syrup 100 100 100
Chemical analyzed (%)
 Moisture 12.31 ± 0.27 11.64 ± 0.24 10.85 ± 0.59
 Crude protein 10.39 ± 0.15 10.34 ± 0.02 10.36 ± 0.15
 Ether extract 0.08 ± 0.00 0.08 ± 0.00 0.08 ± 0.00
 Crude fiber 3.83 ± 0.11 3.84 ± 0.14 3.80 ± 0.08
 Crude ash 6.08 ± 0.31 6.10 ± 0.28 6.11 ± 0.29
 NFE 67.31 ± 0.48 68.00 ± 0.13 68.81 ± 0.72

1) PC, supplementation of basal pollen patty; T1, supplementation of basal pollen diets + 0.04% of CSG; T2, supplementation of basal pollen diets + 0.08% of CSG.

NFE, nitrogen free extract.

Download Excel Table
Chemical compositions of pollen patties

Compositions of moisture content, crude protein, ether extract, crude ash, crude fiber, and nitrogen free extract (NFE) were analyzed according to the standard recommended by the Association of Official Analytical Chemists (AOAC) [25].

Moisture content was calculated by drying the sample in an oven at 100°C for 2 h. The dried sample was placed into desiccators, cooled down and then reweighed. This process was repeated until a constant weight was obtained. Crude protein was analyzed by the Dumas method (Rapid MAX N-Exceed, Elementar, Langenselbold, Germany) [26]. The ether extract was analyzed by using a Soxhlet extractor (EAM model, Misung Scientific, Seoul, Korea) [25]. Crude ash was analyzed according to the method of AOAC by using dry oven circulation (550°C) [25]. The percentage of crude fiber was determined according to the method of AOAC [25]. Calculating the NFE used the following formula: 100 – (Crude protein + ether extract + crude fiber + crude ash+ H2O). All the analyzed data were expressed as mean ± standard deviation.

Body weight

A. mellifera were divided into three body parts to determine the effects of CSG. Total body weight, thorax weight, head weight, and abdomen weight were measured by dehydrating to a persistent temperature (60°C for a period of 48 h) [27].

Diet consumption

The amount of pollen patty consumed was calculated by subtracting the weight of pollen patties and the weight of 1-day-old pollen patties after being placed in the colony (Patty consumption = beginning patty weight-ending patty weight). The weight of pollen patties was measured every day. The data were obtained by recording each formulated diet. The total consumption for each diet during the experimental period (42 days) was also calculated.

Honey production

At the end of the experiment, the production of honey was measured in g by harvesting with an extracting machine (Manual honey harvester) to compare honey production for each colony.

Brood area measurement

Sealed worker brood area was calculated after 14, 28 and 42 days by using measuring a frame wire grid with divisions giving an area of one square inch each [2830] and then converted in to cm2 by multiplying with 2.54. Sealed brood was used as a criterion for evaluating the development of colonies.

Reverse transcription and quantitative polymerase chain reaction

A. mellifera were collected at 42 days, and the head, wings, and legs were removed to obtain the thorax and abdomen. The RNA was extracted from the obtained thorax and abdomen using the total RNA extraction kit (iNtRON Biotechnology, Seongnam, Korea). The mRNA was converted to cDNA using high-capacity cDNA Reverse transcription kit (Applied Biosystems, Waltham, MA, USA). The mixed solution was heat treated at 25°C for 10 min, at 37°C for 2 h, and at 85°C for 5 min. Gene amplification was performed using the Fast qPCR 2 × SYBR Green Master Mix (Applied Biosystems). Gene amplification was performed for 40 cycles as followed cycle: 50°C for 2 min and 95°C for 10 min; 15 secs at 95°C; 1 min at 53°C; 15 secs at 95°C; 1 min at 53°C. The target genes were catalase, thioredoxin reductase 1 (Trxr1), superoxide dismutase 1 (SOD1), superoxide dismutase 2 (SOD2) and glyceraldehyde-3-phosphate dehydrogenase 2 (GAPDH). Primers used in the amplification are shown in Table 2 below. Normalization was performed using the reference gene GAPDH. Relative gene expression was analyzed using the 2−ΔΔCt method [31].

Table 2. Primer sequences used for the RT-qPCR analysis with the Catalase, Trxr1, SOD1, SOD2 and GAPDH genes
Gene Primers Sequence (5’-3’)
Glyceraldehyde-3-phosphate dehydrogenase 2 (GAPDH) Forward CACATGGAAAATTCAAAGGA
Reverse AATGACCAGAAGCTTTTTCC
Thioredoxin reductase 1 (Trxr1) Forward TGTGCTGGATTTTTAAATGG
Reverse TCCACCCAATGTACAAGAAG
Superoxide dismutase 1 (SOD1) Forward CGGCTGAAGTATTCATTACG
Reverse ACGCACACTGCTTTAGTCAT
Superoxide dismutase 2 (SOD2) Forward GAAAATACCATTGCGATTCA
Reverse ATCGGGTCGAACATTTTTAT
Catalase Forward CCACTCATTCCTGTTGGTAA
Reverse GCATCACCGTAAGTGAACAT

RT-qPCR, reverse transcription and quantitative polymerase chain reaction.

Download Excel Table
Statistical analysis

All data were statistically processed using the one-way ANOVA using JMP Pro 16 (JMP® Pro version 16.0.0, SAS Institute, Cary, NC, USA), using each pen as the experimental unit. Differences among all treatment means were determined using the Tukey multiple-range test. The level of significance was established at p < 0.05.

RESULTS

Body weight

As shown in Table 3, thorax weight was significantly increased (p < 0.05) in the T2 diet (9.80 g) compared with the NC (8.90 g) and PC diet (9.00 g) at 42 days. There was no significant difference (p > 0.05) in head, abdomen, and total BW at 0, 14, 28, and 42 days.

Table 3. Mean Thorax, head, abdomen, and total body weight of Apis mellifera with supplementing different pollen patties with curcumin-steviol glycoside complex (CSG)
Items (mg) NC1) PC T1 T2 SEM p-value
0 days
 Thorax 9.70 9.78 9.39 9.25 0.205 0.244
 Head 4.00 3.70 3.98 3.70 0.148 0.460
 Abdomen 18.20 23.30 16.60 24.90 4.496 0.510
 Total BW 36.05 39.93 33.27 35.05 2.055 0.151
14 days
 Thorax 9.47 9.58 9.76 9.55 0.242 0.856
 Head 3.74 3.75 4.17 4.00 0.143 0.117
 Abdomen 23.28 24.44 26.20 26.34 2.341 0.758
 Total BW 35.04 36.02 34.00 34.78 1.359 0.771
28 days
 Thorax 9.36 9.34 8.95 8.89 0.408 0.772
 Head 5.00 5.20 6.00 4.47 0.637 0.406
 Abdomen 30.52 30.76 30.41 32.32 2.554 0.947
 Total BW 36.68 35.20 38.30 37.30 0.003 0.922
42 days
 Thorax 8.90b 9.00b 9.50ab 9.80a 0.183 0.002
 Head 4.05 4.00 4.17 4.05 0.120 0.782
 Abdomen 19.76 21.25 21.78 21.85 0.727 0.168
 Total BW 36.81 37.91 35.80 35.20 1.547 0.625

1) NC, no supplementation of basal pollen patty; PC, supplementation of basal pollen patty; T1, supplementation of basal pollen patty + 0.04% of CSG; T2, supplementation of basal pollen patty + 0.08% of CSG.

a,b Means within column with different superscripts differ significantly (n=3, p < 0.05).

BW, body weight.

Download Excel Table
Diet consumption

As shown in Table 4, there was no significant difference (p > 0.05) in pollen patties consumption among the PC, T1, and T2 diet.

Table 4. Diet consumption of Apis mellifera with supplementing different pollen patties with curcumin-steviol glycoside complex (CSG)
Items (g) PC1) T1 T2 SEM p-value
Daily consumption2) 28.27 27.61 28.03 1.493 0.952

1) PC, supplementation of basal pollen patty; T1, supplementation of basal pollen patty + 0.04% of CSG; T2, supplementation of basal pollen patty + 0.08% of CSG.

2) Each value is the mean value of 3 replicates.

Download Excel Table
Honey production

As shown in Fig. 1, the T1 and T2 diets showed significantly higher (p < 0.05) honey production than the PC and NC diets. Also, the PC diet showed significantly higher (p < 0.05) honey production than the NC diet.

jast-67-2-361-g1
Fig. 1. Honey production of Apis mellifera with supplementing different pollen patties with curcumin-steviol glycoside complex (CSG). All data are presented as mean ± SEM (n = 3). NC, no supplementation of basal pollen patty; PC, supplementation of basal pollen patty; T1, supplementation of basal pollen patty + 0.04% CSG; T2, supplementation of basal pollen diets + 0.08% CSG. a-c Means within column with different superscripts differ significantly (p < 0.05).
Download Original Figure
Brood area

As shown in Fig. 2, the T2 diet showed significantly higher (p < 0.05) brood area than the PC and NC diets at 28 and 42 days. Also, the PC and T1 diets showed significantly higher (p < 0.05) brood areas than the NC diet. There was no significant difference (p > 0.05) at 0 and 14 days.

jast-67-2-361-g2
Fig. 2. Brood area of Apis mellifera with supplementing different pollen patties with curcumin-steviol glycoside complex (CSG). All data are presented as mean ± SEM (n = 3). NC, no supplementation of basal pollen patty; PC, supplementation of basal pollen patty; T1, supplementation of basal pollen patty + 0.04% CSG; T2, supplementation of basal pollen patty + 0.08% CSG. a-c Means within column with different superscripts differ significantly (p < 0.05).
Download Original Figure
Gene expression

As shown in Fig. 3, the T1 and T2 diets showed significantly higher (p < 0.05) Catalase and SOD1 gene expression than the PC and NC diets. The expression level of the Trxr1 gene was significantly higher (p < 0.05) in the T1 diet, and decreased in the order of the PC, T2, and NC diets. The expression level of the SOD2 gene was significantly higher (p < 0.05) in the T1 diet than in other diets and was lower in the NC diet.

jast-67-2-361-g3
Fig. 3. Relative gene expression of Apis mellifera with supplementing different pollen patties with curcumin-steviol glycoside complex (CSG). All data are presented as mean ± SEM (n = 3). NC, no supplementation of basal pollen patty; PC, supplementation of basal pollen patty; T1, supplementation of basal pollen patty + 0.04% CSG; T2, supplementation of basal pollen patty + 0.08% CSG. a-c Means within column with different superscripts differ significantly (p < 0.05). Trxr 1, Thioredoxin reductase 1; SOD 1, Superoxide dismutase 1; SOD 2, Superoxide dismutase 2.
Download Original Figure

DISCUSSION

Total body, thorax, head, and abdomen weight

A higher thorax weight in A. mellifera has been suggested to induce stronger and more agile flight, which improves their foraging activities [32]. Numerous studies have demonstrated the positive correlation between thorax weight and flight performance [33,34]. Therefore, higher thorax weight is considered an index of higher flight performance in A. mellifera [35,36].

During the flight, A. mellifera significantly increases its metabolic rate, which, in turn, increases its flight foraging activity times in collecting pollen [37,38]. Carbohydrate catabolism plays a major role in producing an adequate metabolic rate to improve flight in A. mellifera [39]. Also, Teulier et al. [40] have demonstrated that A. mellifera utilizes carbohydrates as a metabolic fuel for flight. Moreover, Brodschneider et al. [35] have reported that when insufficient nutrition is provided, delayed maturation of the enzymes of carbohydrate metabolism induces impaired flight performance, which decreases the thorax weight in A. mellifera.

In this study, we observed a higher thorax weight and amount of NFE in supplementation of CSG. According to Ghosh and Jung [9], the NFE represents the soluble carbohydrates in pollen patties. This result indicates that supplementation of CSG increases the content of the carbohydrate in the pollen patty. Also, a previous study has reported that supplementation of curcumin could increase the digestibility of carbohydrates by improving intestinal enzymes [41]. Therefore, increased thorax weight might be reasonable due to the increase of carbohydrate and enhanced utilization of carbohydrates by supplementing CSG in this study.

In contrast, no significant differences were observed in total body, head, and abdomen weight in this study. Previous studies demonstrated that supplementation of dietary protein increases the size of the hypopharyngeal gland, which results in a higher head weight in A. mellifera [42,43]. Also, Ullah et al. [44] reported that the highest body weight was observed when sufficient protein (30 g of soybean flour) was available. However, there were no sufficient differences in the crude protein content of pollen patties (0.06%–0.08%) between the cases of supplementation or non-supplementation of CSG in this study. Although the recommended amount of protein in pollen patty has not been identified, it demonstrates that the amount of protein in pollen patty may be insufficient to increase the weight of honeybees. Therefore, a higher amount of protein in the pollen patty might be required to increase the body weight of A. mellifera.

Diet consumption

Dietary curcumin consumption implicates the prevention of oxidative stress, which results in enhanced longevity in A. mellifera [45]. In addition, Avni et al. [46] have demonstrated that greater consumption of supplements (such as protein and carbohydrates) led to enhanced brood production and tended toward higher honey yields as well. Regarding diet consumption, several studies have indicated that diets with additional nutrition supplements were consumed at higher rates relative to diets without the additional nutrient supplementation [1,10,47]. Also, Anvi et al. [46] have reported that pollen patties consisting only of carbohydrates were more consumed than those consisting of protein and lipid sources. Similarly, Scheiner et al. [48] have demonstrated that high sucrose concentrations increase the phagostimulating effects to induce the consumption of pollen patties. Therefore, we guessed that diet consumption might be increased due to the supplementation of pollen patty with CSG. However, no significant differences were noted in the total diet consumption between the supplementation of pollen patties with CSG and those without it. These results indicate that the NFE (differences among the PC, T1, and the T2 diets: 0.69%–1.50%) was insufficient to trigger the phagostimulating effects of increasing the consumption of pollen patties containing the CSG.

Honey production

The amount of honey production is correlated with pollen collection and consumption in honeybees [10]. Insufficient nutrient supplementation causes impaired strength and health in A. mellifera, which accounts for the decreased foraging activity in terms of collecting pollen into their colonies [1,2,49]. The present results confirmed that the supplementation of pollen patties with CSG yielded higher honey production compared to that without the supplementation. As shown in Table 1, pollen patties with the CSG showed relatively higher NFE levels (0.69%–1.50%) to the non-supplementation of CSG. Carbohydrates are considered a major source of fuel for foraging flights, which refers to the activity of collecting pollen in the honey colonies [50]. Thus, carbohydrate supplements could provide sufficient nutrients to the colonies and increase honey production by improving their strength and health. Numerous studies have reported that the supplementation of pollen patties enriched with carbohydrates increased honey production when compared to the case of non-supplementation of pollen patties to the colonies [4,5153]. Therefore, increased honey production might be reasonable due to the supplementation of pollen patty with CSG in A. mellifera.

Brood area

In this study, the supplementation of pollen patties with CSG resulted in improved brood area. The brood area at day 42 was approximately 10% higher in the T2 supplemented with pollen patty than in NC without pollen patty supplementation. In addition, the T2 supplemented with the CSG showed a significantly higher area than the PC. Supplementing A. mellifera with additives possessing antioxidant properties has been shown to improve their health and functionality [5456]. Curcumin, when used in feeding, can reduce oxidative stress through its antioxidant function [18,19]. Tawfik et al. [57] have reported that reducing oxidative stress improves the colony strength and health of honeybees. The size of the brood area is highly correlated with the number of colonies and populations as it can predict the number of new bee larvae born [58]. As a result, improving the brood area could improve the colony strength and, thus, increase the honey production [40]. Based on the above results, we suggest that supplementing CSG when feeding pollen supplements to bees can improve their brood area.

Gene expression

In this study, the expression of genes related to antioxidants, Catalase, and SOD1 was significantly higher in the T1 and T2 supplemented with the CSG. In addition, the treatment group fed with pollen patties showed significantly higher values than the NC treatment for Trxr1 and SOD2. It shows a similar trend to the results of Alaux’s study [59] analyzing gene expression after feeding pollen patties to A. mellifera. Feeding pollen patty appears to increase the expression of antioxidant genes and adding 4% of the CSG appears to further improve it. Bees can fly up to 7km a day to collect pollen or nectar in nature [60,61]. Flight requires a lot of energy, which increases metabolism. Additionally, it triggers the production and accumulation of ROS in the body, causing faster aging [62,63]. ROS causes significant oxidative stress in A. mellifera [646]. A decrease in the health and lifespan of bees can lead to weakened colony strength and decreased productivity [67]. Rueppell et al. [67] have reported that delaying nurse-to-forager can increase lifespan by up to 8-fold. In other words, the lifespan of A. mellifera improves when ROS production decreases due to the absence of flight for pollen or nectar collection. Catalase, SOD1, SOD2, and Trxr1 measured in this study are considered powerful enzymes that can remove ROS [68,69]. Feeding pollen patty and supplementing with CSG is expected to reduce oxidative stress by increasing the expression of antioxidant enzymes and improving the health of bees.

CONCLUSION

In this study, supplementation of pollen patties with CSG showed improved thorax weight, honey production, brood area, and antioxidant gene expression. This result indicates that supplementing pollen patties with a CSG enhanced the performance of A. mellifera. Therefore, CSG as supplement to pollen patty might be the ideal strategy to improve A. mellifera performances.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This research was supported by Chungbuk National University KNUDP program (2023).

Acknowledgements

Not applicable.

Availability of data and material

All data generated or analyzed during this study are included in this published article.

Authors’ contributions

Conceptualization: Choi J, Cho J.

Data curation: Park G, Song D.

Formal analysis: Chang S, Jeon K.

Methodology: Song D, An J, Ahn K.

Software: Chang S, Kim H, Lim Y.

Validation: Song D, Kim J.

Investigation: Choi J, Cho J.

Writing - original draft: Park S, Lee J, Park G, Choi J, Cho J.

Writing - review & editing: Park S, Lee J, Park G, Song D, Chang S, An J, Jeon K, Kim H, Lim Y, Kim J, Ahn K, Choi J, Cho J.

Ethics approval and consent to participate

This article does not require IRB/IACUC approval because there are no human and animal participants.

REFERENCES

1.

Mattila HR, Otis GW. Influence of pollen diet in spring on development of honey bee (Hymenoptera: Apidae) colonies. J Econ Entomol. 2006; 99:604-13

2.

Manning R. Fatty acids in pollen: a review of their importance for honey bees. Bee World. 2001; 82:60-75

3.

Saffari A, Kevan PG, Atkinson J. Consumption of three dry pollen substitutes in commercial apiaries. J Apic Sci. 2010; 54:5-12

4.

Islam N, Mahmood R, Sarwar G, Ahmad S, Abid S. Development of pollen substitute diets for Apis mellifera ligustica colonies and their impact on brood development and honey production. Pak J Agric Res. 2020; 33:381-8

5.

Higes M, Martín-Hernández R, Garrido-Bailón E, González-Porto AV, García-Palencia P, Meana A, et al. Honeybee colony collapse due to Nosema ceranae in professional apiaries. Environ Microbiol Rep. 2009; 1:110-3

6.

Aizen MA, Harder LD. The global stock of domesticated honey bees is growing slower than agricultural demand for pollination. Curr Biol. 2009; 19:915-8

7.

Al-Ghamdi AA, Al-Khaibari AM, Omar MO. Consumption rate of some proteinic diets affecting hypopharyngeal glands development in honeybee workers. Saudi J Biol Sci. 2011; 18:73-7

8.

Mahmood R, Wagchoure ES, Sarwar G. Influence of supplemental diets on Apis mellifera L. colonies for honey production. Pak J Agric Res. 2013; 26:290-4

9.

Ghosh S, Jung C. Nutritional evaluation of four commercially available pollen patties in Korea. J Apic. 2015; 30:155-60

10.

Safari AM, Kevan PG, Atkinson JL, Guzman-Novoa E. Feed-Bee: a new bee feed is added to the menu. Bee Culture. 2006; 134:47-8

11.

DeGrandi-Hoffman G, Wardell G, Ahumada-Segura F, Rinderer T, Danka R, Pettis J. Comparisons of pollen substitute diets for honey bees: consumption rates by colonies and effects on brood and adult populations. J Apic Res. 2008; 47:265-70

12.

Sihag RC, Gupta M. Development of an artificial pollen substitute/supplement diet to help tide the colonies of honeybee (Apis mellifera L.) over the dearth season. J Apic Sci. 2011; 55:15-29

13.

Kalev H, Dag A, Shafir S. Feeding pollen supplements to honey bee colonies during pollination of sweet pepper in enclosures. Am Bee J. 2002; 142:675-9

14.

Keller I, Fluri P, Imdorf A. Pollen nutrition and colony development in honey bees-part II. Bee World. 2005; 86:27-34

15.

Ak T, Gülçin İ. Antioxidant and radical scavenging properties of curcumin. Chem Biol Interact. 2008; 174:27-37

16.

Wilken R, Veena MS, Wang MB, Srivatsan ES. Curcumin: a review of anti-cancer properties and therapeutic activity in head and neck squamous cell carcinoma. Mol Cancer. 2011; 10:12

17.

Bland SD, Venable EB, McPherson JL, Atkinson RL. Effects of liposomal-curcumin on five opportunistic bacterial strains found in the equine hindgut - preliminary study. J Anim Sci Technol. 2017; 59:15

18.

Yan E, Zhang J, Han H, Wu J, Gan Z, Wei C, et al. Curcumin alleviates IUGR jejunum damage by increasing antioxidant capacity through Nrf2/Keap1 pathway in growing pigs. Animals. 2020; 10:41

19.

Trujillo J, Chirino YI, Molina-Jijón E, Andérica-Romero AC, Tapia E, Pedraza-Chaverrí J. Renoprotective effect of the antioxidant curcumin: recent findings. Redox Biol. 2013; 1:448-56

20.

Recharla N, Balasubramanian B, Song M, Puligundla P, Kim SK, Jeong JY, et al. Dietary turmeric (Curcuma longa L.) supplementation improves growth performance, short-chain fatty acid production, and modulates bacterial composition of weaned piglets. J Anim Sci Technol. 2021; 63:575-92

21.

Kharat M, McClements DJ. Recent advances in colloidal delivery systems for nutraceuticals: a case study – delivery by design of curcumin. J Colloid Interface Sci. 2019; 557:506-18

22.

Zhang F, Koh GY, Jeansonne DP, Hollingsworth J, Russo PS, Vicente G, et al. A novel solubility-enhanced curcumin formulation showing stability and maintenance of anticancer activity. J Pharm Sci. 2011; 100:2778-89

23.

Ju DL. The efficacy and safety of non-nutritive sweeteners. J Korean Diabetes. 2015; 16:281-6

24.

Zhang J, Hu Z, Lu C, Bai K, Zhang L, Wang T. Effect of various levels of dietary curcumin on meat quality and antioxidant profile of breast muscle in broilers. J Agric Food Chem. 2015; 63:3880-6

25.

AOAC (Association of Official Analytical Chemists) International. Official methods of analysis of AOAC International. 18th ed Washington, DC: AOAC. 2007

26.

Jung S, Rickert DA, Deak NA, Aldin ED, Recknor J, Johnson LA, et al. Comparison of Kjeldahl and Dumas methods for determining protein contents of soybean products. J Am Oil Chem Soc. 2003; 80:1169-73

27.

Sagili RR, Pankiw T, Zhu-Salzman K. Effects of soybean trypsin inhibitor on hypopharyngeal gland protein content, total midgut protease activity and survival of the honey bee (Apis mellifera L.). J Insect Physiol. 2005; 51:953-7

28.

Sabir AM, Suhail A, Akram W, Sarwar G, Saleem M. Effect of some pollen substitute diets on the development of Apis mellifera L. colonies. Pak J Biol Sci. 2000; 3:890-1

29.

Seeley TD, Mikheyev AS. Reproductive decisions by honey bee colonies: tuning investment in male production in relation to success in energy acquisition. Insectes Soc. 2003; 50:134-8

30.

Amir OG, Peveling R. Effect of triflumuron on brood development and colony survival of free-flying honeybee, Apis mellifera L. J Appl Entomol. 2004; 128:242-9

31.

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001; 25:402-8

32.

Hendriksma HP, Pachow CD, Nieh JC. Effects of essential amino acid supplementation to promote honey bee gland and muscle development in cages and colonies. J Insect Physiol. 2019; 117:103906

33.

Ahmed ZH, Tawfik AI, Abdel-Rahman MF, Moustafa AM. Nutritional value and physiological effects of some proteinaceous diets on honey bee workers (Apis mellifera L.). Bee World. 2020; 97:26-31

34.

Scofield HN, Mattila HR. Honey bee workers that are pollen stressed as larvae become poor foragers and waggle dancers as adults. PLOS ONE. 2015; 10e0121731

35.

Brodschneider R, Riessberger-Gallé U, Crailsheim K. Flight performance of artificially reared honeybees (Apis mellifera). Apidologie. 2009; 40:441-9

36.

Jang H, Ghosh S, Sun S, Cheon KJ, Mohamadzade Namin S, Jung C. Chlorella-supplemented diet improves the health of honey bee (Apis mellifera). Front Ecol Evol. 2022; 10:922741

37.

Nachtigall W, Hanauer-Thieser U, Mörz M. Flight of the honey bee VII: metabolic power versus flight speed relation. J Comp Physiol B. 1995; 165:484-9

38.

Harrison JF, Fewell JH. Environmental and genetic influences on flight metabolic rate in the honey bee, Apis mellifera. Comp Biochem Physiol A Mol Integr Physiol. 2002; 133:323-33

39.

Suarez RK. Energy metabolism during insect flight: biochemical design and physiological performance. Physiol Biochem Zool. 2000; 73:765-71

40.

Teulier L, Weber JM, Crevier J, Darveau CA. Proline as a fuel for insect flight: enhancing carbohydrate oxidation in hymenopterans. Proc R Soc B Biol Sci. 2016; 283:20160333

41.

Jiménez-Osorio AS, Monroy A, Alavez S. Curcumin and insulin resistance—molecular targets and clinical evidences. BioFactors. 2016; 42:561-80

42.

Hrassnigg N, Crailsheim K. Adaptation of hypopharyngeal gland development to the brood status of honeybee (Apis mellifera L.) colonies. J Insect Physiol. 1998; 44:929-39

43.

Rinkevich FD, Margotta JW, Pittman JM, Ottea JA, Healy KB. Pteridine levels and head weights are correlated with age and colony task in the honey bee, Apis mellifera. PeerJ. 2016; 4e2155

44.

Ullah A, Shahzad MF, Iqbal J, Baloch MS. Nutritional effects of supplementary diets on brood development, biological activities and honey production of Apis mellifera L. Saudi J Biol Sci. 2021; 28:6861-8

45.

Strachecka AJ, Olszewski K, Paleolog J. Curcumin stimulates biochemical mechanisms of Apis mellifera resistance and extends the apian life-span. J Apic Sci. 2015; 59:129-41

46.

Avni D, Dag A, Shafir S. The effect of surface area of pollen patties fed to honey bee (Apis mellifera) colonies on their consumption, brood production and honey yields. J Apic Res. 2009; 48:23-8

47.

Saffari AM, Kevan PG, Atkinson JL. A promising pollen substitute for honey bees. Am Bee J. 2004; 144:230-1

48.

Scheiner R, Page RE, Erber J. Sucrose responsiveness and behavioral plasticity in honey bees (Apis mellifera). Apidologie. 2004; 35:133-42

49.

Lamontagne-Drolet M, Samson-Robert O, Giovenazzo P, Fournier V. The impacts of two protein supplements on commercial honey bee (Apis mellifera L.) colonies. J Apic Res. 2019; 58:800-13

50.

Sammataro D, Weiss M. Comparison of productivity of colonies of honey bees, Apis mellifera, supplemented with sucrose or high fructose corn syrup. J Insect Sci. 2013; 13:19

51.

Shehata IAA. Evaluation of Carniolan and Italian honey bee colonies fed on artificial diets in dearth and flowering periods under Nasr city conditions. Int J Environ. 2016; 5:19-25

52.

Abd El-Wahab TE, Ghania AMM, Zidan EW. Assessment a new pollen supplement diet for honey bee colonies and their effects on some biological activities. Int J Agric Technol. 2016; 12:55-62

53.

Ahmad S, Khan KA, Khan SA, Ghramh HA, Gul A. Comparative assessment of various supplementary diets on commercial honey bee (Apis mellifera) health and colony performance. PLOS ONE. 2021; 16e0258430

54.

Hu X, Wang H, Lei C, Zhao X, Zhang W, Liu Z, et al. Effect of supplemental pantothenic acid on lipid metabolism and antioxidant function of Apis mellifera worker bees. J Apic Res. 2022; 63:721-31

55.

Farjan M, Dmitryjuk M, Lipiński Z, Biernat-Łopieńska E, Żółtowska K. Supplementation of the honey bee diet with vitamin C: the effect on the antioxidant system of Apis mellifera carnica brood at different stages. J Apic Res. 2012; 51:263-70

56.

Skowronek P, Wójcik Ł, Strachecka A. CBD supplementation has a positive effect on the activity of the proteolytic system and biochemical markers of honey bees (Apis mellifera) in the apiary. Animals. 2022; 12:2313

57.

Tawfik AI, Ahmed ZH, Abdel-Rahman MF, Moustafa AM. Influence of winter feeding on colony development and the antioxidant system of the honey bee, Apis mellifera. J Apic Res. 2020; 59:752-63

58.

Eckert CD, Winston ML, Ydenberg RC. The relationship between population size, amount of brood, and individual foraging behaviour in the honey bee, Apis mellifera L. Oecologia. 1994; 97:248-55

59.

Alaux C, Dantec C, Parrinello H, Le Conte Y. Nutrigenomics in honey bees: digital gene expression analysis of pollen’s nutritive effects on healthy and varroa-parasitized bees. BMC Genomics. 2011; 12:496

60.

Rissato SR, Galhiane MS, De Almeida MV, Gerenutti M, Apon BM. Multiresidue determination of pesticides in honey samples by gas chromatography–mass spectrometry and application in environmental contamination. Food Chem. 2007; 101:1719-26

61.

Pahl M, Zhu H, Tautz J, Zhang S. Large scale homing in honeybees. PLOS ONE. 2011; 6e19669

62.

Margotta JW, Roberts SP, Elekonich MM. Effects of flight activity and age on oxidative damage in the honey bee, Apis mellifera. J Exp Biol. 2018; 221jeb183228

63.

Corona M, Hughes KA, Weaver DB, Robinson GE. Gene expression patterns associated with queen honey bee longevity. Mech Ageing Dev. 2005; 126:1230-8

64.

He B, Liu Z, Wang Y, Cheng L, Qing Q, Duan J, et al. Imidacloprid activates ROS and causes mortality in honey bees (Apis mellifera) by inducing iron overload. Ecotoxicol Environ Saf. 2021; 228:112709

65.

Korayem AM, Khodairy MM, Abdel-Aal AA, El-Sonbaty AA. The protective strategy of antioxidant enzymes against hydrogen peroxide in honey bee, Apis mellifera during two different seasons. J Biol Earth Sci. 2012; 2:B93-109

66.

Olgun T, Dayioğlu M, Özsoy N. Pesticide and pathogen induced oxidative stress in honey bees (Apis mellifera L.). Mellifera. 2020; 20:32-52

67.

Rueppell O, Bachelier C, Fondrk MK, Page RE. Regulation of life history determines lifespan of worker honey bees (Apis mellifera L.). Exp Gerontol. 2007; 42:1020-32

68.

Li X, Wang Y, Li M, Wang H, Dong X. Metal complexes or chelators with ROS regulation capacity: promising candidates for cancer treatment. Molecules. 2021; 27:148

69.

Vives‐Bauza C, Starkov A, Garcia‐Arumi E. Measurements of the antioxidant enzyme activities of superoxide dismutase, catalase, and glutathione peroxidase. Methods Cell Biol. 2007; 80:379-93

PDF Download
PubReader
Export Citation
Email the Author

Metrics

View
6,276
Download
1,785
Crossref
0
Scopus
0

QR Code of this Article:




Revised Publication Charge


(Effective for articles submitted beginning January 1, 2026)

The publication charge is 1,500,000 Korean Won per article for members of the Korean Society of Animal Science and Technology (KSAST), and 2,000,000 Korean Won for non-members. First and corresponding authors are required to pay the annual membership fee.

The publication charge for a corresponding author outside Korea is 1,500 US dollars per article.


I don't want to open this window for a day.