RESEARCH ARTICLE

Genetic insights into avian influenza resistance in Jeju Island chickens: the roles of Mx1 and oligoadenylate synthetase-like single nucleotide polymorphisms

Young-Won Kim1https://orcid.org/0000-0002-8102-8325, Seohyun Jeong1https://orcid.org/0000-0002-2383-2024, Ju-Hee Yang2https://orcid.org/0000-0001-6436-7395, Dongseob Tark2https://orcid.org/0000-0001-7499-4253, Woo Hyun Kim3https://orcid.org/0000-0002-6874-6787, Hyoung-Seok Yang4https://orcid.org/0000-0003-4500-8826, Seong-Hwan Mun4https://orcid.org/0000-0003-0638-0983, Sung Hyun Kang5https://orcid.org/0000-0001-6745-8196, Eun-A Ko6https://orcid.org/0000-0002-1585-6886, Jae-Hong Ko1,*https://orcid.org/0000-0003-0391-3959
Author Information & Copyright
1Department of Physiology, College of Medicine, Chung-Ang University, Seoul 06974, Korea
2Laboratory for Infectious Disease Prevention, Korea Zoonosis Research Institute, Jeonbuk National University, Iksan 54531, Korea
3College of Veterinary Medicine & Institute of Animal Medicine, Gyeongsang National University, Jinju 52828, Korea
4Veterinary Research Institute, Jeju 63344, Korea
5Chungcheong Regional Center for Disease Control and Prevention, Korea Disease Control and Prevention Agency, Daejeon 35208, Korea
6Department of Physiology, School of Medicine, Jeju National University, Jeju 63243, Korea
*Corresponding author: Jae-Hong Ko, Department of Physiology, College of Medicine, Chung-Ang University, Seoul 06974, Korea. Tel: +82-2-820-5647, E-mail: akdongyi01@cau.ac.kr

© Copyright 2025 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Jan 15, 2025; Revised: Jan 17, 2025; Accepted: Jan 20, 2025

Published Online: Jan 31, 2025

Abstract

Influenza A virus (FLUAV) causes serious diseases in both poultry and humans. Various host proteins, including Mx1, are considered candidates for avian influenza (AI) resistance. After infecting Jeju Native chicken embryo fibroblasts (CEFs) with three types of AI viruses, we performed gene expression profiling, identified single nucleotide polymorphisms (SNPs) through RNA-sequencing, and confirmed phenotypes showing antiviral activity in vitro. Highly pathogenic AI viruses upregulated FGF2, LYN, and FLT4 and downregulated HGF, ANGPT1, and ROR2, while a low pathogenicity AI upregulated PARK7, RACK1, and DTX3L and downregulated SIRT1, LRRK2, and WAC. However, no virus affected Mx1 expression. Although SNPs in Mx1 could not discriminate antiviral activity alone, the only CEF resistant to H5N6, strain AN4, contained the Mx1 631 R/R genotype and strongly expressed an oligoadenylate synthetase-like (OASL) variant with a unique SNP: c.G880A (p.E294K). Using transfected cell lines, H5N6-infected cells expressing OASL with the c.G880A SNP showed minimal cytopathic effects and the lowest M gene expression. This study confirms that Jeju Native chickens with specific SNP combinations in both Mx1 and OASL showed H5N6 resistance and demonstrates the interplay of genetic factors in host–pathogen dynamics, suggesting a need for integrated analyses of multiple resistance genes to inform AI prevention strategies.

Keywords: Avian influenza virus; H5N6; Viral resistance; Mx1; Oligoadenylate synthetase-like (OASL); Single nucleotide polymorphism

INTRODUCTION

Influenza A virus (FLUAV) is a representative RNA virus that can be transmitted from wild birds to poultry and can spread throughout the body and respiratory tract, causing serious diseases [1,2]. Highly pathogenic avian influenza (HPAI) viruses cause serious infections in poultry and humans [3,4], and if pathways for RNA viruses to circulate and produce modified copies by mutation, genetic recombination, and genetic reassortment were to develop, a global pandemic could occur, causing significant economic losses [2,5,6]. Although there is a focus on developing poultry vaccines, avian influenza (AI) poses challenges because mutations are common and the vaccine’s efficacy is reduced in immunocompromised individuals. This has fueled debate over vaccine effectiveness among scientists, as poultry HPAI outbreaks have been reported in countries where vaccinations have already been administered [710].

Animal host cells have proteic mechanisms that suppress viruses [11]. Representative proteins primarily responsible for cellular immunity include protein kinase R (PKR), 2’,5’-oligoadenylate synthetase (OAS)/ribonuclease L, adenosine deaminase RNA specific, and myxovirus (influenza virus) resistance 1, interferon (IFN)-inducible protein p78 (mouse) (Mx1) [12,13]. These proteins are reported to be expressed within cells after virus or IFN stimulation, conferring infection resistance [1417]. However, their specific immune defense mechanisms remain unclear, and although we can now artificially synthesize the AI virus, its ability to transform in vivo makes interpreting experimental results difficult [10,13,18]. Known candidate genes related to AI resistance include Mx1, TLR7, RIG-I, MDA-5, NLGN4, and GAP43 [1923], but no single gene has produced clear, consistent results [23,24]. This is because there are specific regions that exhibit antiviral effects against specific viruses, and different genotypes exist, each with distinct single nucleotide polymorphisms (SNPs) [19,25,26]. The existence of highly resistant genotypes underscores the need for active research to elucidate their genetic specificity.

Due to the limitations of poultry vaccines, there is an urgent need to identify AI-resistant genes and their relevant SNPs, as they can be used to build a biological defense system by replacing susceptible varieties with resistant ones. As the ultimate goal of this research is to prevent the spread of AI from wild birds to chickens, we selected breeds raised in Jeju, a Korean island where controlling anthropogenic risks is quite easy and AI incidence is relatively low (Fig. 1). After infecting chicken embryo fibroblasts (CEFs) from these breeds with three types of AI viruses, we performed gene expression profiling, identified SNPs through RNA-sequencing (RNA-seq), and confirmed the phenotypes of the identified genes in vitro to provide an appropriate strategy for selecting and developing AI-resistant chickens.

jast-67-1-69-g1
Fig. 1. Representative poultry farms and breeds in Jeju. Statistics on FLUAV outbreaks in farms in Korea from 2018 to 2022. Black dots indicate farms with outbreaks, and red dots indicate the number of breeding farms. FLUAV, influenza A virus.
Download Original Figure

MATERIALS AND METHODS

Viruses

We used two HPAI strains, H5N1 and H5N6, and one low pathogenicity avian influenza (LPAI) strain, H9N2. Strain H5N1 was obtained from the Korea Veterinary Culture Collection (KVCC-VR1300046). We isolated H5N6 from duck (Anas platyrhynchos) feces and H9N2 from laying hens (Gallus gallus). Experiments employing HPAI were approved by the Institutional Biosafety Committee of Jeonbuk National University (approval no. JBNU 2021-06-005) and performed in accordance with current guidelines and regulations for high-risk pathogen handling.

Animals and primary cells

A total of 70 chickens were purchased from seven Jeju Island farms (Fig. 2A), with age and sex being random. This work was approved by the Institutional Animal Care and Use Committee of the Veterinary Research Institute, Jeju Special Self-Governing Province (approval No. 2020-2) and performed in accordance with current animal testing regulations. We anesthetized the animals by intravenous injection with a combination of ketamine and xylazine (20 and 2 mg/kg, respectively), and after confirming the absence of the flexion reflex, chickens were euthanized by intracardiac injection with T-61 (0.3 mL/kg).

jast-67-1-69-g2
Fig. 2. Mx1 gene characterization of Jeju native fowls and related poultry breeds. (A) we obtained muscle tissues and/or eggs of broilers, laying hens, Korean native chickens, and Jeju Native Fowls from 7 farms. Each dot represents the location of a poultry farm and each color indicates a specific breed. The BJ Farm has been breeding two breeds, Woormatdak and Jeju Native Fowl. The HDF farm is the one farm at which HPAI broke out in 2021. (B) A representative image of an Mx1 gene PCR-RFLP gel (Asn, N; Ser, S; digestion with RsaI, R; digestion with SspI, S; and digestion without a restriction enzyme, Ctrl) and the distribution of Mx genotypes in Jeju native chicken breeds. (C) The full-length cDNA sequences of the Mx gene. HPAI, highly pathogenic avian influenza; PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism.
Download Original Figure

Eggs from Jeju Native chicken and Woormatdak breeds were sourced from BJ Farm. Embryonic tissues from the fertilized eggs of Jeju Native chickens, incubated for 11 d, were used for DNA extraction and CEF isolation. Samples were categorized into three groups based on their Mx1 genotype at position 631, i.e., serine (S) vs. asparagine (N): AN (Jeju Native chicken 1, Mx N/N type), AS (Jeju Native chicken 1, Mx S/S type), and MS (Woormatdak, Mx S/S type). Primary CEFs were cultured from these embryonic tissues [27], and cells between passages 5 and 8 were used for subsequent experiments (Table 1 and Fig. 3).

Table 1. Sample information for object identification and hierarchical grouping
Group Breed Mx1 genotype FLUAV Biological replicate
Control A N N 4
A S N 4
M S N 4
Infection A N H5N1 4
A S H5N1 3
M S H5N1 4
A N H5N6 4
A S H5N6 3
M S H5N6 4
A N H9N2 4
A S H9N2 4
M S H9N2 4

FLUAV, influenza A virus.

Download Excel Table
jast-67-1-69-g3
Fig. 3. Experimental design of FLUAVs infection for RNA-seq. The filled inverted triangle indicates the time point at which cells are washed with PBS and incubated with the addition of fresh medium. CEF, chicken embryo fibroblast; FLUAV, influenza A virus; PBS, phosphate-buffered saline; RNA-seq, RNA-sequencing.
Download Original Figure

Genome-based polymerase chain reaction- restriction fragment length polymorphism genotyping

DNeasy Blood & Tissue kits (Qiagen, Darmstadt, Germany) were used to extract DNA from the limbs of chick embryos. A PCR-RFLP analysis targeting the Mx variation at position 631 was then conducted for CEF classification. The PCR products produced by primers targeting the S type and N type (Table 2) were digested with RsaI (ER1122, Thermo Scientific, Vilnius, Lithuania) and SspI (ER0772, Thermo Scientific), respectively.

Table 2. Primers and probe sequences used in the study
Gene Primers name Sequence (5’→3’)
Mx1 MX/S F: CCTTCAGCCTGTTTTTCTCCTTTTAGGA
R: CAGAGGAATCTGATTGCTCAGGCGTGTA
MX/R F: CCTTCAGCCTGTTTTTCTCCTTTTAGGA
R: TCAGAGGAATCTGATTGCTCAGGCGAATA
MX_FUL F: ATAGAGCAAGCCAGAAGAACAGCAG
R: GCTTTGACAAGGGTAGGCATATCAG
MX_Ex F: CTAGCTAGCATGAACAATCCA
R: AATGCGGCCGCGAAGAAATCTACAGAGACT
MX_INS F: TACACACAAAGCACACACCC
R: AGGACAGTAGAGAGGATGAT
OASL OASL_FUL F: GTGGTGAGCGGAATGGAG
R: TTCAGAGTTCACAGCTTTTATTCC
OASL_Ex F: CTAGCTAGCACCATGGAGCTGGGCGTGAGGT
R: AATGCGGCCGCTTGGAGGAGCTCAGGAGGGCA
OASL_INS F: GGTGCTCTTCATCAACTGCTTCTC
R: AGACTGTGGTGCTGGGGTGGAC
pCI-neo Vec_INS F: CTGGGCAGGTAAGTATCAA
R: AAAAACCTCCCACATCTCC
Metrix M F: AGATGAGTCTTCTAACCGAGGTCG
R: TGCAAAAACATCTTCAAGTCTCTG
P: FAM-TCAGGCCCCCTCAAAGCCGA-TAMRA
mGapdh mGapdh F: GCATGGCCTTCCGTGTTC
R: GATGTCATCATACTTGGCAGGTTT
P: FAM-TCGTGGATCTGACGTGCCGCC-TAMRA
Download Excel Table
Infection in chicken embryo fibroblasts

CEFs were divided into three groups and inoculated with H5N1 (n = 11), H5N6 (n = 11), and H9N2 (n = 12) (multiplicity of infection = 0.1). An uninfected control group of CEFs (n = 12) was also included. After 7 h, total RNA was harvested from each CEF strain using Trizol (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. The RNA samples were submitted to Macrogen (Seoul, Korea) for RNA-seq. AI infection was confirmed by observing cytopathic effects (CPEs) using crystal violet staining, with AI resistance quantified as the 50% tissue culture infective dose (TCID50) [28,29].

RNA-sequencing

Libraries were prepared using TruSeq Stranded mRNA LT Sample Prep kits following the TruSeq Stranded mRNA Sample Preparation Guide (Part # 15031047 Rev. E or # 1000000040498v00), and 151 bp paired-end sequencing was performed on the Illumina platform. For bioinformatic processing, we used FastQC (v0.11.7) to ensure the RNA-seq data quality, and adaptor sequences, contamination, and low-quality reads were removed using Trimmomatic (v0.38). Reads were then mapped using HISAT2 (v2.1.0) through the Bowtie2 aligner (v2.3.4.1). For each sample, we quantified all known mRNA transcripts in the Ensembl chicken gene annotation (GRCg6a) using StringTie (v2.1.3b). Differentially expressed genes (DEGs) were identified as those exhibiting a |fold change (fc)| ≥ 2 and raw p-value < 0.05 using the R packages DESeq2, when the number of biological replicates per group was ≥ 3, or edgeR, when it was < 3 [30].

To identify SNPs across various genes, functional genomics reads from each available replicate of the CEFs were aligned to the reference genome using STAR (v2.6.0c) in two-pass mode to improve alignment accuracy. Gene annotations in GTF format were incorporated, and the alignments were output as coordinate-sorted BAM files. These BAM files were indexed using SAMtools (v1.9) for efficient data processing. SNP detection was performed using BCFtools (v1.9). Variants were called by aggregating sequencing data at each genomic position with bcftools mpileup, followed by identification using bcftools call. To ensure the reliability of the detected variants, the resulting VCF files were filtered with the vcfutils.pl varFilter script included in BCFtools. Variants meeting stringent criteria—a minimum quality score of 20 and a minimum read depth of 100—were retained to ensure high confidence and sufficient coverage. Special attention was given to SNPs within target genes for subsequent analyses.

Plasmids construction

To construct the target genes, RNA from the CEFs and RNA to cDNA EcoDry Premix (Double Primed) (Clontech Laboratories, Kusatsu, Japan) were used for cDNA synthesis, and then cDNA from the Mx1 and OAS-like (OASL) mRNA fragments (identified based on accession nos. NM_204609.2 and NM_001397447.1, respectively) were amplified with primer pairs targeting the full-length sequences (Table 2) using SeqAmp™ DNA Polymerase (Clontech Laboratories). The purified amplicons were cloned into pTOPcloner™ Blunt (Enzynomics, Daejeon, Korea). Each clone was then cloned into the expression vector pCI-neo (Promega, Fitchburg, WI, USA), creating plasmids pCI-neo-Mx1 and pCI-neo-OASL.

Transfection

To assess the effects of target gene overexpression, mouse fibroblasts (BALB/3T3 clone A31) were transfected with an empty vector (control), one of two Mx1 variants, or one of four OASL variants in 100 mm dishes using FuGENE 6 (Promega). Colonies of G418 (600 µg/mL)-resistant cells were selected, and transfection efficiency was confirmed with PCR and sequencing.

Virus production (M gene copy number) quantification

RNA was isolated from Balb/3T3 cells using TRIzol Reagent (Invitrogen) and from culture supernatants using Trizol LS (Invitrogen). Quantitative PCR (qPCR) was performed using GDX Probe 1-step RT-PCR Master Mix (GDX, Seoul, Korea) on a LightCycler 2.0 instrument (Roche, Basel, Switzerland) using primers detailed in Table 2.

Statistical analysis

The resistance to H5N6 infection was assessed using TCID50 values, presented as the mean ± SD of two technical replicates from four biological replicates. Virus production by SNPs was evaluated based on the relative expression of the M gene, showed as the mean ± SD of two technical replicates from three biological replicates. Statistical significance was determined using one-way ANOVA with Tukey’s post hoc test in R.

RESULTS

Gene dysregulation patterns and dysregulated pathways in Jeju CEFs infected with FLUAVs

The Mx1 genotypes were confirmed for seven chicken breeds from six farms, with 10 muscle samples collected per farm (Figs. 2A and 2B). Three breeds, Woormatdak, Hanhyup, and Broiler, carried only the S/S genotype, and two, Lay Hens and Jeju Native, exhibited both N/S and S/S genotypes. Notably, while Jeju Native chickens from three farms were studied, only those raised at the BJ Farm carried all three genotypes, N/N, N/S, and S/S. Therefore, Jeju Native chickens from the BJ and Livestock Promotion Agency (LPA) farms as well as Woormatdak chickens from the BJ Farm were selected for full Mx1 cDNA sequencing using fertilized eggs. Although the Mx1 gene sequences were consistent with the reference sequence over much of their length, variations were observed. Additionally, shared sequences were identified between Jeju Native chickens from the LPA and Woormatdak chickens from the BJ Farm (Fig. 2C). Thus, CEFs representing three types, all from chickens reared separately on the same farm, the BJ Farm, were selected for further analysis: Jeju Native CEFs carrying the AI-resistant N/N Mx1 genotype (labeled AN), Jeju Native CEFs carrying the AI-sensitive S/S Mx1 genotype (labeled AS), and Woormatdak CEFs carrying the AI-sensitive S/S Mx1 genotype (labeled MS). A total of 46 samples derived from 12 eggs were included in the study. After stratifying and grouping the genotypes, each group was infected with one of the three FLUAVs (Table 1 and Fig. 3). Expression patterns formed three well-distinguished clusters (Fig. 4A): one shared by the CEFs infected with two HPAI viruses and two unique clusters corresponding to the LPAI-infected and non-infected CEFs (Fig. 4B). Gene ontology (GO) analysis revealed that, compared to the controls, the genes dysregulated in FLUAV-infected CEFs were significantly associated with GO biological process (GOBP) terms related to infection pathology, including “translation,” “peptide biosynthetic process,” “ribosome biogenesis,” and “nucleoside triphosphate metabolic process.” Additionally, many ribosomal protein genes, EIF3J, and MCTS1 were upregulated, while BTG2 and EIF2AK3 were downregulated (Fig. 5A). Notably, there were large differences between expression change patterns induced by HPAI and LPAI viruses. Under HPAI infection, GOBP terms related to immune response, inflammation regulation, and tissue repair—such as “cytokine production,” “negative regulation of cell population proliferation,” and “positive regulation of cell migration”—were significant, and genes such as FGF2, LYN, and FLT4 were upregulated, while genes such as HGF, ANGPT1, and ROR2 were downregulated (Figs. 5B, 5C, and 5D). Conversely, under LPAI infection, upregulated genes included PARK7, RACK1, and DTX3L, and downregulated genes included SIRT1, LRRK2, and WAC, all of which are associated with GOBP terms related to gene expression and protein function regulation, including “chromatin organization,” “histone modification,” and “protein modification by small protein conjugation.” Contrary to expectations, the Mx1 gene was not differentially expressed in any group (Fig. 5E).

jast-67-1-69-g4
Fig. 4. Overview of differentially expressed genes (DEGs) in chicken embryo fibroblasts (CEFs), analyzed using RNA-seq data. (A) A multidimensional scaling plot of whole-genome expression. Points represent individual CEF samples, which form three distinct clusters: one shared by the CEFs infected with the two HPAI strains, and two unique clusters representing the LPAI and non-infected CEFs. (B) A heat map of hierarchically clustered genes. RNA-seq, RNA-sequencing; HPAI, highly pathogenic avian influenza; LPAI, low pathogenicity avian influenza.
Download Original Figure
jast-67-1-69-g5
Fig. 5. Gene ontology analysis of the DEGs in the CEFs. The top 10 GOBP terms associated with (A) FLUAV, (B) HPAI, (C) H5N1, (D) H5N6, and (E) H9N2 infection. Statistical significance is indicated by asterisks. ***adjusted p < 0.001, **adjusted p < 0.01. DEGs, differentially expressed genes; CEFs, chicken embryo fibroblasts; GOBP, gene ontology biological process; FLUAV, influenza A virus; HPAI, highly pathogenic avian influenza.
Download Original Figure
Gene-enrichment patterns show resistance to H5N6

Using H5N6, virus infectivity in CEFs was confirmed by observing CPE. While it is known for conferring resistance, the AI-resistant Mx1 gene SNP could not predict H5N6 resistance alone. Interestingly, only one CEF showed resistance to H5N6 (Fig. 6). This CEF, dubbed AN4, had the Mx1 631 R/R genotype. Therefore, RNA-seq data were reanalyzed across three comparisons using 11 samples: (1) the H5N6-infected AN4 individual vs. the uninfected control AN4 individual, (2) H5N6-infected individuals AN1–AN3 vs. the H5N6-infected AN4 individual, and (3) the 10 H5N6-infected individuals (excluding the H5N6-infected AN4 individual) vs. the H5N6-infected AN4 individual. In comparison (1), 2,009 DEGs were identified in the AN4 individual depending on infection status (Fig. 7A). Notably, while the top GO term for all CEFs under H5N6 infection was “cytokine production,” it shifted to “response to growth factor” when focusing on the AN4 individuals (Fig. 7C). However, it is important to note that these terms remain closely interconnected in biological processes like inflammation, tissue repair, and immune response (Figs. 5B, 5C, 5D, and 7C). In comparison (2), 545 DEGs were identified when comparing the three infected AN1–AN3 individuals, which had the same Mx1 genotype and were from the same farm, with the H5N6-infected AN4 individual (Fig. 7A). Genes that were significantly related to immune response, including FGF10 (upregulated), NFIB (upregulated), EPHA4 (upregulated), F2RL1 (downregulated), STK39 (downregulated), and COLEC10 (downregulated), were associated with GOBP terms such as “positive regulation of phagocytosis,” “response to vitamin,” and “phosphatidylserine metabolic process” (Fig. 7D). In comparison (3), 498 DEGs were detected in all H5N6-infected CEFs relative to the H5N6-infected AN4 individual, including FGF10 (upregulated), NFIB (upregulated), ROBO1 (upregulated), GPER1 (downregulated), TGFB3 (downregulated), and LAMA1 (downregulated), which were associated with GOBP terms such as “negative regulation of cell population proliferation,” “metal ion transport,” “head development,” and “vasculature development,” indicating their potential roles in regulating proliferation, ion homeostasis, and developmental processes (Figs. 7A and 7E).

jast-67-1-69-g6
Fig. 6. Quantal infectivity. H5N6 infection resistance effect, as determined using CPEs, expressed as TCID50 values. The results are presented as the mean ± SD of duplicate measures. Statistical significance, assessed using a one-way ANOVA and Tukey’s post hoc test, is indicated by asterisks. ***p < 0.001. CEFs, chicken embryo fibroblasts.
Download Original Figure
jast-67-1-69-g7
Fig. 7. Differentially expressed gene (DEG) and gene ontology (GO) analyses focusing on H5N6-infected AN4 individuals. (A) The number of significant DEGs, as determined by fold change values and p-values, and (B) a heat map of hierarchically clustered genes focusing on the H5N6-infected AN4 individual. The top 10 GO biological process terms associated with (C) the H5N6-infected AN4 individual vs. the uninfected control AN4 individual, (D) H5N6-infected individuals AN1–AN3 vs. the H5N6-infected AN4 individual, and (E) the 10 H5N6-infected individuals (excluding the H5N6-infected AN4 individual) vs. the H5N6-infected AN4 individual.
Download Original Figure
An OASL SNP confers H5N6 resistance

We identified GOBP terms based on specific keywords, focusing on the keyword “virus,” and investigated the associated genes. The genes identified in comparison (3) we investigated were OASL and protein tyrosine phosphatase receptor type C (PTPRC). Among the H5N6-infected AN individuals, OASL was strongly expressed in AN4 (Fig. 7B). We focused on this and performed additional single-nucleotide variant calling to determine whether OASL has an SNP associated with infection resistance, revealing a unique SNP of OASL that was only observed in the called sequence of AN4: c.G880A (p.E294K) (Fig. 8A). The full-length sequence of AN4’s OASL mRNA was extracted from AN4’s cDNA, and a construct was created enabling its overexpression. Most cells remained viable (over 80% viability), so Mx1 and OASL overexpression did not cause cytotoxicity. Thus, H5N6 virus infectivity was evaluated by observing CPE and M gene PCR. All cells exhibited morphological changes after H5N6 infection. However, cells transfected with OASL containing the c.G880A SNP showed minimal morphological changes and had the lowest expression value of the M gene (Figs. 8B and 8C).

jast-67-1-69-g8
Fig. 8. Functional analysis of Mx1 and OASL in H5N6-Infected Balb/3T3 cells. (A) Constructs containing the full-length gene sequences of Mx1 and OASL from Jeju native chickens were verified by RT-PCR, confirming correct insertion, orientation, and transfection efficiency. Gel images display four lanes with primer combinations: Vec_INS F + target_INS R (Lane 1), target_INS F + target_INS R (Lane 2), target_INS F + Vec_INS R (Lane 3), and Vec_INS F + Vec_INS R (Lane 4). (B) Representative images showing Balb/3T3 cell morphologies, and (C) M gene PCR results showing the mean ± SD of three biological replicates. Statistical significance, assessed using a one-way ANOVA and Tukey’s post hoc test, is indicated by asterisks: ***p < 0.001, **p < 0.01. OASL, oligoadenylate synthase-like; RT-PCR, real-time polymerase chain reaction.
Download Original Figure

DISCUSSION

In order to discover chicken breeds resistant to AI, which threatens public health and causes huge losses to farms every year, we performed an RNA-seq analysis by infecting fibroblasts from chickens maintained on Jeju Island with H5N1, H5N6, and H9N2, viruses mainly observed in the wild. Jeju is the optimal region in Korea for discovering and maintaining AI-resistant genes or host individuals [31]. To precisely identify host susceptibility/resistance-related genes and SNPs, DEGs were characterized, and AI infection was associated with GOBP terms related to infection pathology in the host and significantly increased the expression of PTPRC and OASL in particular (Fig. 7B). The protein encoded by PTPRC, commonly referred to as CD45, belongs to the protein tyrosine phosphatase (PTP) family. PTPs function as key signaling molecules, regulating diverse cellular processes such as cell growth, differentiation, mitosis, and oncogenic transformation [32]. Interestingly, different viruses have evolved distinct mechanisms to target PTPRC. For instance, in studies involving human immunodeficiency virus 1, PTPRC expression was upregulated during infection acquisition, potentially serving as a hallmark of increased virus acquisition risk alongside activation of the IFN response pathway [33]. In contrast, PTPRC is downregulated in T cells infected with roseoloviruses, while human cytomegalovirus and murine cytomegalovirus interfere with PTPRC signaling and transport [33]. Our findings align with observations in which PTPRC expression is upregulated upon infection acquisition, highlighting the need for a deeper understanding of the host immune response to specific viral infections.

While highly pathogenic H5N1 has attracted global attention due to its wider geographical range and the large human population it affects, another highly pathogenic virus, H5N6, deserves as much attention, if not more, due to its broad genetic range and the increasing human populations afflicted in the regions where it is found, particularly in East Asia [34]. Recently, H5N1 and H5N6 co-infections with a variety of strains [35] and reassortants [36] have been confirmed. Because H9N2 shows low pathogenicity, it has continued to spread in wild populations and has served as a donor virus contributing internal genes to newly emerging AI viruses, expanding their host range and increasing their pathogenicity and transmissibility in mammals [37]. The severity and transmissibility of diseases are determined by not only viral mutations but also host factors and/or host–pathogen interactions [38]. While LPAI infections are generally mild, they may increase the risk of secondary bacterial infections, and at least some LPAI viruses can cause systemic and fatal diseases in turkeys [39]. Therefore, it is essential to evaluate the resistance to LPAIs and HPAIs exhibited by transformants of innate immunity genes before attempting preventive measures including vaccine development. In this study, we failed to demonstrate an antiviral effect of Mx1 N631 in the CEFs using the three FLUAVs. The Mx1 gene did not show significant changes pattern in expression across the AI-infected and the uninfected control groups. This observation can be understood within several contexts. In a previous study, we characterized the diversity of PKR and Mx protein sequences in chicken breeds maintained in Japan, discovering among them an Mx gene subtype that conferred resistance to HPAI (H5N1) [19,40]. After Mx1 transfection, cells exhibited sensitivity to H5N1 when amino acid 631 in the Mx protein was S and resistance when it was N. Ewald et al. [41] evaluated whether Mx1 631 heterozygosity influences the pathogenesis of HPAI using N/N, S/S, and N/S commercial broiler strains. When challenged intranasally with an HPAI strain (H5N2), chickens homozygous for N631 were significantly more resistant than those homozygous for S631, providing evidence for an in vivo antiviral effect of Mx1. However, Schusser et al. [42], who performed infection experiments using chicken embryonic fibroblasts with Mx 631 polymorphisms and introduced reverse-transcribed viral vectors for the expression of Mx isoforms into chicken cells and embryonated eggs, found that neither N631 nor S631 isoforms provided antiviral protection against several LPAI and HPAI strains. Furthermore, they provided evidence that the antiviral effect of type I IFN in chicken cells is independent of Mx using short interfering RNA-mediated knockdown, suggesting that other IFN-inducible factors must contribute to FLUAV suppression. Considering such opposing results, we suggest that it is unreliable to predict HPAI resistance based on Mx1 expression level alone without a close examination of multiple key factors. Instead, the presence of specific SNPs, along with interactions between other immune-related genes, may play a more critical role. Lee et al. [43] analyzed miRNA expression profiles following HPAI H5N1 virus infection in resistant and susceptible Ri chicken lines. Chickens were classified based on A/G alleles of specific genes, including Mx. The study identified potential regulation of miRNAs targeting candidate genes associated with immune responses to HPAI infection. This highlights the importance of shifting from single-gene analyses to exploring broader genetic networks contributing to resistance.

We confirmed that a chicken breed with both the AI-resistant Mx1 (p.S631N) and Jeju-specific OASL subtype (p.E294K) exhibited HPAI (H5N6) resistance (Figs. 2C, 6, and 8). The OASL family of antiviral proteins plays a crucial role in the antiviral signal transduction pathway mediated by IFNs. This system is an essential part of the IFN-induced antiviral defense against the encephalomyocarditis virus, reovirus, and the vaccinia virus [44,45]. However, it is not yet known whether the presence of these proteins can prevent the initial transmission of FLUAVs from wild birds to domestic poultry, a key question for poultry health. Uchida et al. [46] suggested the need to elucidate the role of OASL through recombinant HPAI virus infection experiments. A study published in 2024 [47] demonstrated that chicken OASL targets VP2, a key protein of infectious bursal disease virus (IBDV), inducing its degradation through the autophagy pathway and thereby inhibiting IBDV replication. Additionally, a 2022 study [48] revealed that the structure and immune-regulatory functions of chicken OASL are similar to those of mammalian ISG15, suggesting its critical role in the innate immune response of chickens. Nevertheless, no study to date has reported the independent antiviral activity of OASL against HPAI in poultry. The OAS family proteins are known to exhibit antiviral effects against various viruses through two major pathways [44,4951], but the intracellular antiviral mechanism of OASL requires further study. Our results revealed the OASL gene contains an infection resistance-conferring SNP that enhances the host’s defense against H5N6 infection (Figs. 6, 8B, and 8C). Among the OASL subtype family members, human OASL and mouse OASL2 show the same SNP as the Jeju Island-specific OASL subtype (Fig. 8A). This SNP is positioned close to the OAS-specific motif RPVILDPADP and lies in one of the alpha-helices of human OAS1 [52,53]. Although a direct relationship between this domain and antiviral activity has not been confirmed, further studies on the OASL subtype identified in this research are expected to provide critical insights into the antiviral mechanisms against HPAI.

To exclude interference from other candidate genes, we performed infection experiments using mammalian 3T3 cell lines in which Mx1 and OASL gene variants were individually inserted and expressed. The expression of genes with resistance-associated SNPs enhanced antiviral activity over that of their corresponding reference sequence gene (Fig. 8). These results suggest a need for an integrated analysis of multiple genes that show resistance while accounting for virus type and environmental factors, moving beyond the searches for AI resistance factors that have focused on Mx1 or a single gene.

Unfortunately, we were unable to amplify the virus sufficiently to demonstrate a correlation between H5N1 infection and the antiviral activity of OASL. However, it has been reported that H5N1 infection upregulates the expression of Mx1 and OASL in resistant R1 chickens carrying the resistant-type Mx1 gene (N631) and the BF2/B21 haplotype [54]. This suggests that further experiments with H5N1 may yield results similar to those seen with H5N6 infection in the current study. In addition, given the results of our cell-infection experiments, follow-up research is needed to verify the protective effects of the identified Mx1 and OASL variants in vivo and develop experimental techniques that can easily type each gene using genomic DNA extracted from small amounts of blood or tissue. Our research team has completed the development of a PCR-RFLP method that can efficiently identify OASL SNPs showing antiviral activity against H5N6 and is using it in combination with existing technology that can identify Mx amino acid 631 to genetically characterize chickens. To support the preservation and development of breeds, the experimental results have been shared with the local government agency (Jeju Special Self-Governing Province Livestock Promotion Agency) responsible for maintaining and supplying the ancestral lines of farm chickens used in this study. Collaborative efforts are underway to ensure the thorough management of these breeds and to register their genetic resource information.

In conclusion, we observed that, among the chicken breeds maintained on Jeju Island, individuals with specific SNP combinations in Mx and OASL showed antiviral activity against H5N6. In addition, we suggested the need to characterize candidate innate immunity genes and conduct AI-resistance studies that use combinations of multiple genes and incorporate virus type and environmental characteristics, moving beyond single-gene antiviral activity studies. Based on these results, it is expected that it will be possible to overcome the limitations of preventive vaccines and establish a biological defense system that can block the spread of AI from the wild to humans at the intermediate host while reducing economic losses caused by mass culling of poultry.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This work was supported by the Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, and Forestry (IPET) through the Animal Disease Management Technology Development Program, funded by the Ministry of Agriculture, Food, and Rural Affairs (MAFRA) [grant number RS-2019-IP119052]. This study was also supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF), funded by the Ministry of Education [grant number 2017R1D1A1B06035273].

Acknowledgements

We would like to thank the Korean Cell Line Bank, Korea Veterinary Culture Collection, Jeju Special Self-Governing Province Veterinary Research Institute, and Jeju Special Self-Governing Province Livestock Promotion Agency for their assistance in this research.

Availability of data and material

Upon reasonable request, the RNA sequencing data of this study can be available from the corresponding author.

Authors’ contributions

Conceptualization: Kim YW, Ko JH.

Data curation: Kim YW.

Formal analysis: Kim YW, Kang SH, Ko EA.

Methodology: Jeong S, Yang JH, Yang HS.

Validation: Tark D, Kim WH, Mun SH, Ko JH.

Investigation: Jeong S, Yang JH, Yang HS.

Writing - original draft: Kim YW, Ko JH.

Writing - review & editing: Kim YW, Jeong S, Yang JH, Tark D, Kim WH, Yang HS, Mun SH, Kang SH, Ko EA, Ko JH.

Ethics approval and consent to participate

Experiments employing HPAI were approved by the Institutional Biosafety Committee of Jeonbuk National University (approval no. JBNU 2021-06-005) and performed in accordance with current guidelines and regulations for high-risk pathogen handling. This work was approved by the Institutional Animal Care and Use Committee of the Veterinary Research Institute, Jeju Special Self-Governing Province (approval No. 2020-2) and performed in accordance with current animal testing regulations.

REFERENCES

1.

Malik Peiris JS. Avian influenza viruses in humans. Rev Sci Tech. 2009; 28:161-73

2.

Bi Y, Yang J, Wang L, Ran L, Gao GF. Ecology and evolution of avian influenza viruses. Curr Biol. 2024; 34:R716-21

3.

European Food Safety Authority, European Centre for Disease Prevention and Control, European Union Reference Laboratory for Avian Influenza, Adlhoch C, Fusaro A, Gonzales JL, et al. Avian influenza overview April - June 2023. EFSA J. 2023 21e08191

4.

Tiwari A, Meriläinen P, Lindh E, Kitajima M, Österlund P, Ikonen N, et al. Avian influenza outbreaks: human infection risks for beach users - one health concern and environmental surveillance implications. Sci Total Environ. 2024; 943:173692

5.

Pérez-Losada M, Arenas M, Galán JC, Palero F, González-Candelas F. Recombination in viruses: mechanisms, methods of study, and evolutionary consequences. Infect Genet Evol. 2015; 30:296-307

6.

Shi J, Zeng X, Cui P, Yan C, Chen H. Alarming situation of emerging H5 and H7 avian influenza and effective control strategies. Emerg Microbes Infect. 2023 12e2155072

7.

Spackman E, Swayne DE. Vaccination of gallinaceous poultry for H5N1 highly pathogenic avian influenza: current questions and new technology. Virus Res. 2013; 178:121-32

8.

Cha RM, Smith D, Shepherd E, Davis CT, Donis R, Nguyen T, et al. Suboptimal protection against H5N1 highly pathogenic avian influenza viruses from Vietnam in ducks vaccinated with commercial poultry vaccines. Vaccine. 2013; 31:4953-60

9.

Hafez MH, Arafa A, Abdelwhab EM, Selim A, Khoulosy SG, Hassan MK, et al. Avian influenza H5N1 virus infections in vaccinated commercial and backyard poultry in Egypt. Poult Sci. 2010; 89:1609-13

10.

Abdel-Moneim AS, Afifi MA, El-Kady MF. Genetic drift evolution under vaccination pressure among H5N1 Egyptian isolates. Virol J. 2011; 8:283

11.

Magor KE, Miranzo Navarro D, Barber MR, Petkau K, Fleming-Canepa X, Blyth GA, et al. Defense genes missing from the flight division. Dev Comp Immunol. 2013; 41:377-88

12.

Boo KH, Yang JS. Intrinsic cellular defenses against virus infection by antiviral type I interferon. Yonsei Med J. 2010; 51:9-17

13.

Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev. 2001; 14:778-809

14.

Clemens MJ, Elia A. The double-stranded RNA-dependent protein kinase PKR: structure and function. J Interferon Cytokine Res. 1997; 17:503-24

15.

Player MR, Torrence PF. The 2-5A system: modulation of viral and cellular processes through acceleration of RNA degradation. Pharmacol Ther. 1998; 78:55-113

16.

Bass BL. RNA editing and hypermutation by adenosine deamination. Trends Biochem Sci. 1997; 22:157-62

17.

Haller O, Frese M, Kochs G. Mx proteins: mediators of innate resistance to RNA viruses. Rev Sci Tech. 1998; 17:220-30

18.

Zhou A, Paranjape JM, Der SD, Williams BR, Silverman RH. Interferon action in triply deficient mice reveals the existence of alternative antiviral pathways. Virology. 1999; 258:435-40

19.

Ko JH, Jin HK, Asano A, Takada A, Ninomiya A, Kida H, et al. Polymorphisms and the differential antiviral activity of the chicken Mx gene. Genome Res. 2002; 12:595-601

20.

Xing Z, Harper R, Anunciacion J, Yang Z, Gao W, Qu B, et al. Host immune and apoptotic responses to avian influenza virus H9N2 in human tracheobronchial epithelial cells. Am J Respir Cell Mol Biol. 2011; 44:24-33

21.

Barber MR, Aldridge JR, Jr, Webster RG, Magor KE. Association of RIG-I with innate immunity of ducks to influenza. Proc Natl Acad Sci USA. 2010; 107:5913-8

22.

Karpala AJ, Stewart C, McKay J, Lowenthal JW, Bean AG. Characterization of chicken Mda5 activity: regulation of IFN-β in the absence of RIG-I functionality. J Immunol. 2011; 186:5397-405

23.

Drobik-Czwarno W, Wolc A, Fulton JE, Arango J, Jankowski T, O’Sullivan NP, et al. Identifying the genetic basis for resistance to avian influenza in commercial egg layer chickens. Animal. 2018; 12:1363-71

24.

Drobik-Czwarno W, Wolc A, Fulton JE, Jankowski T, Arango J, O’Sullivan NP, et al. Genetic basis of resistance to avian influenza in different commercial varieties of layer chickens. Poult Sci. 2018; 97:3421-8

25.

Ko JH, Takada A, Mitsuhashi T, Agui T, Watanabe T. Native antiviral specificity of chicken Mx protein depends on amino acid variation at position 631. Anim Genet. 2004; 35:119-22

26.

Watanabe T. Polymorphisms of the chicken antiviral MX gene. Cytogenet Genome Res. 2007; 117:370-5

27.

Bernasconi D, Schultz U, Staeheli P. The interferon-induced Mx protein of chickens lacks antiviral activity. J Interferon Cytokine Res. 1995; 15:47-53

28.

Reed LJ, Muench H. A simple method for estimating fifty percent endpoints. Am J Epidemiol. 1938; 27:493-7

29.

Karakus U, Crameri M, Lanz C, Yángüez E. Propagation and titration of influenza viruses.In: In: Yamauchi Y, editor.editor. Influenza virus: methods in molecular biology. New York, NY: Humana Press. 2018; p. p. 59-88

30.

Schurch NJ, Schofield P, Gierliński M, Cole C, Sherstnev A, Singh V, et al. How many biological replicates are needed in an RNA-seq experiment and which differential expression tool should you use?. RNA. 2016; 22:839-51

31.

Jun B, Kim I, Shin J, Kwon H. Development of landscape conservation value map of Jeju island, Korea for integrative landscape management and planning using conservation value of landscape typology. PeerJ. 2021 9e11449

32.

Al Barashdi M, Ali A, McMullin MF, Mills K. Protein tyrosine phosphatase receptor type C (PTPRC or CD45). J Clin Pathol. 2021; 74:548-52

33.

Whyte ML, Smith KA, Buchberger A, Berg Luecke L, Tjan LH, Mori Y, et al. The roseoloviruses downregulate the protein tyrosine phosphatase PTPRC (CD45). J Virol. 2021 95e0162820

34.

Gu W, Shi J, Cui P, Yan C, Zhang Y, Wang C, et al. Novel H5N6 reassortants bearing the clade 2.3.4.4b HA gene of H5N8 virus have been detected in poultry and caused multiple human infections in China. Emerg Microbes Infect. 2022; 11:1174-85

35.

Heo GB, Kang YM, An SH, Kim Y, Cha RM, Jang Y, et al. Concurrent infection with clade 2.3.4.4b highly pathogenic avian influenza H5N6 and H5N1 viruses, South Korea, 2023. Emerg Infect Dis. 2024; 30:1223-7

36.

Cho AY, Si YJ, Kim DJ, Seo YR, Lee DY, Kim D, et al. Novel avian influenza A(H5N6) virus in wild birds, South Korea, 2023. Emerg Infect Dis. 2024; 30:1285-8

37.

Guan Y, Shortridge KF, Krauss S, Webster RG. Molecular characterization of H9N2 influenza viruses: were they the donors of the “internal” genes of H5N1 viruses in Hong Kong?. Proc Natl Acad Sci USA. 1999; 96:9363-7

38.

Layton DS, Butler J, Stewart C, Stevens V, Payne J, Rootes C, et al. H7N9 bearing a mutation in the nucleoprotein leads to increased pathology in chickens. Front Immunol. 2022; 13:974210

39.

Tumpey TM, Kapczynski DR, Swayne DE. Comparative susceptibility of chickens and turkeys to avian influenza A H7N2 virus infection and protective efficacy of a commercial avian influenza H7N2 virus vaccine. Avian Dis. 2004; 48:167-76

40.

Ko JH, Asano A, Kon Y, Watanabe T, Agui T. Characterization of the chicken PKR: polymorphism of the gene and antiviral activity against vesicular stomatitis virus. Jpn J Vet Res. 2004; 51:123-33

41.

Ewald SJ, Kapczynski DR, Livant EJ, Suarez DL, Ralph J, McLeod S, et al. Association of Mx1 Asn631 variant alleles with reductions in morbidity, early mortality, viral shedding, and cytokine responses in chickens infected with a highly pathogenic avian influenza virus. Immunogenetics. 2011; 63:363-75

42.

Schusser B, Reuter A, von der Malsburg A, Penski N, Weigend S, Kaspers B, et al. Mx is dispensable for interferon-mediated resistance of chicken cells against influenza A virus. J Virol. 2011; 85:8307-15

43.

Lee S, Kang S, Heo J, Hong Y, Vu TH, Truong AD, et al. MicroRNA expression profiling in the lungs of genetically different Ri chicken lines against the highly pathogenic avian influenza H5N1 virus. J Anim Sci Technol. 2023; 65:838-55

44.

Marques J, Anwar J, Eskildsen-Larsen S, Rebouillat D, Paludan SR, Sen G, et al. The p59 oligoadenylate synthetase-like protein possesses antiviral activity that requires the C-terminal ubiquitin-like domain. J Gen Virol. 2008; 89:2767-72

45.

Kennedy RB, Poland GA, Ovsyannikova IG, Oberg AL, Asmann YW, Grill DE, et al. Impaired innate, humoral, and cellular immunity despite a take in smallpox vaccine recipients. Vaccine. 2016; 34:3283-90

46.

Uchida Y, Watanabe C, Takemae N, Hayashi T, Oka T, Ito T, et al. Identification of host genes linked with the survivability of chickens infected with recombinant viruses possessing H5N1 surface antigens from a highly pathogenic avian influenza virus. J Virol. 2012; 86:2686-95

47.

Wang S, Xu Z, Liu Y, Yu M, Zhang T, Liu P, et al. OASL suppresses infectious bursal disease virus replication by targeting VP2 for degrading through the autophagy pathway. J Virol. 2024 98e0018124

48.

Shepard JD, Freitas BT, Rodriguez SE, Scholte FEM, Baker K, Hutchison MR, et al. The structure and immune regulatory implications of the ubiquitin-like tandem domain within an avian 2’-5’ oligoadenylate synthetase-like protein. Front Immunol. 2022; 12:794664

49.

Ghosh A, Shao L, Sampath P, Zhao B, Patel NV, Zhu J, et al. Oligoadenylate-synthetase-family protein OASL inhibits activity of the DNA sensor cGAS during DNA virus infection to limit interferon production. Immunity. 2019; 50e5

50.

Ishibashi M, Wakita T, Esumi M. 2’,5’-Oligoadenylate synthetase-like gene highly induced by hepatitis C virus infection in human liver is inhibitory to viral replication in vitro. Biochem Biophys Res Commun. 2010; 392:397-402

51.

Lin RJ, Yu HP, Chang BL, Tang WC, Liao CL, Lin YL. Distinct antiviral roles for human 2’,5’-oligoadenylate synthetase family members against dengue virus infection. J Immunol. 2009; 183:8035-43

52.

Ibsen MS, Gad HH, Andersen LL, Hornung V, Julkunen I, Sarkar SN, et al. Structural and functional analysis reveals that human OASL binds dsRNA to enhance RIG-I signaling. Nucleic Acids Res. 2015; 43:5236-48

53.

Yang C, Liu F, Chen S, Wang M, Jia R, Zhu D, et al. Identification of 2’-5’-oligoadenylate synthetase-like gene in goose: gene structure, expression patterns, and antiviral activity against Newcastle disease virus. J Interferon Cytokine Res. 2016; 36:563-72

54.

Vu TH, Hong Y, Truong AD, Lee S, Heo J, Lillehoj HS, et al. The highly pathogenic H5N1 avian influenza virus induces the mitogen-activated protein kinase signaling pathway in the trachea of two Ri chicken lines. Anim Biosci. 2022; 35:964-74

Revised Publication Charge


(Effective for articles submitted beginning January 1, 2026)

The publication charge is 1,500,000 Korean Won per article for members of the Korean Society of Animal Science and Technology (KSAST), and 2,000,000 Korean Won for non-members. First and corresponding authors are required to pay the annual membership fee.

The publication charge for a corresponding author outside Korea is 1,500 US dollars per article.


I don't want to open this window for a week.