RESEARCH ARTICLE

Molecular analysis of chicken interferon-alpha inducible protein 6 gene and transcriptional regulation

Jeong-Woong Park1,#https://orcid.org/0000-0003-0885-3078, Marc Ndimukaga1,#https://orcid.org/0000-0001-8061-7753, Jaerung So1https://orcid.org/0000-0001-6786-6894, Sujung Kim1https://orcid.org/0000-0003-2037-0298, Anh Duc Truong2https://orcid.org/0000-0002-2472-8165, Ha Thi Thanh Tran2https://orcid.org/0000-0001-7342-8815, Hoang Vu Dang2,*https://orcid.org/0000-0003-0006-7902, Ki-Duk Song1,3,4,*https://orcid.org/0000-0003-2827-0873
Author Information & Copyright
1Department of Animal Biotechnology, Jeonbuk National University, Jeonju 54896, Korea
2Vietnam National Institute of Veterinary Research, Ha Noi 100000, Viet Nam
3Department of Agricultural Convergence Technology, Jeonbuk National University, Jeonju 54896, Korea
4The Animal Molecular Genetics and Breeding Center, Jeonbuk National University, Jeonju 54896, Korea
*Corresponding author Hoang Vu Dang, Vietnam National Institute of Veterinary Research, Ha Noi 100000, Viet Nam. Tel: +84-2438694082, E-mail: dangvuhoang@nivr.gov.vn
*Corresponding author Ki-Duk Song, Department of Agricultural Convergence Technology, Jeonbuk National University, Jeonju 54896, Korea. Tel: +82-63-219-5523, E-mail: kiduk.song@jbnu.ac.kr

#These authors contributed equally to this work.

© Copyright 2023 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Aug 14, 2022; Revised: Oct 23, 2022; Accepted: Nov 02, 2022

Published Online: Jan 31, 2023

Abstract

Interferon-alpha inducible protein 6 (IFI6) is an interferon-stimulated gene (ISG), belonging to the FAM14 family of proteins and is localized in the mitochondrial membrane, where it plays a role in apoptosis. Transcriptional regulation of this gene is poorly understood in the context of inflammation by intracellular nucleic acid-sensing receptors and pathological conditions caused by viral infection. In this study, chicken IFI6 (chIFI6) was identified and studied for its molecular features and transcriptional regulation in chicken cells and tissues, i.e., lungs, spleens, and tracheas from highly pathogenic avian influenza virus (HPAIV)-infected chickens. The chIFI6-coding sequences contained 1638 nucleotides encoding 107 amino acids in three exons, whereas the duck IFI6-coding sequences contained 495 nucleotides encoding 107 amino acids. IFI6 proteins from chickens, ducks, and quail contain an IF6/IF27-like superfamily domain. Expression of chIFI6 was higher in HPAIV-infected White Leghorn chicken lungs, spleens, and tracheas than in mock-infected controls. TLR3 signals regulate the transcription of chIFI6 in chicken DF-1 cells via the NF-κB and JNK signaling pathways, indicating that multiple signaling pathways differentially contribute to the transcription of chIFI6. Further research is needed to unravel the molecular mechanisms underlying IFI6 transcription, as well as the involvement of chIFI6 in the pathogenesis of HPAIV in chickens.

Keywords: Interferon-alpha inducible protein 6 gene; Avian influenza virus; Toll-like receptor 3 signaling pathway; NF-κB pathway; MAPKs pathway, DF-1 cells

INTRODUCTION

Avian influenza viruses (AIVs) are single-stranded RNA viruses belonging to the Orthomyxoviridae family that infect a variety of birds. Influenza viruses are classified into three types based on their nucleoproteins and matrix proteins (A, B, and C). Type A influenza viruses (H1N1 and H5N1 among others) are the most virulent and have been shown to be the most pathogenic for humans and other mammals [1]. Furthermore, influenza A viruses can be classified as avian influenza (H5N1), swine influenza (H1N1), or other types of animal influenza viruses based on their origin host. The subtype H5 of highly pathogenic avian influenza viruses (HPAIVs) is classified into multiple clades based on the hemagglutinin (HA) protein [24]. Depending on their pathogenicity in chickens, they can be divided into two pathotypes. Low-pathogenic AIVs (LPAIVs) are often significantly less virulent, causing mild to severe respiratory disease, as well as a decrease in water or feed consumption and egg production. HPAIVs, however, usually cause fatal infections in chickens [14]. HPAIVs are a major economic problem in the poultry industry because of their high mortality rates.

Influenza-induced apoptosis has been observed in a range of cells, including retinal pigment bronchial [5] nasopharyngeal, lung [6,7], and porcine epithelial cells from the intestine and airway [810], natural killer cells [11], and human lung ex vivo cultures [12]. Apoptosis can be caused by either direct synthesis of apoptotic mediators or indirect activity of inflammatory mediators and the release of death ligands from infected cells. The influenza virus reportedly triggers apoptosis both in vitro [13,14,15,16] and in vivo [17].

H5N1 virus-induced apoptosis was reportedly delayed in primary human peripheral blood monocyte-derived macrophages, compared to seasonal influenza-infected cells. Given that the intrinsic pathway is responsible for apoptosis [16], the human H5N1 influenza virus enhances production of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and promotes apoptosis in the surrounding cells via cell–cell interaction [18]. H1N1 and H5N1 viruses have been linked to the altered expression of apoptosis-related genes in human lung epithelial cells and mice [19,20].

After infection with the influenza virus, type I interferons (IFNs) are immediately activated and play a pivotal role in inhibiting viral replication and activating innate immune responses by initiating transcription of IFN response genes [21,22]. IFNs are a family of secreted cytokines [23,24] that exert their biological activities by binding specific cell membrane receptors to trigger a well characterized intracellular signaling pathway [25,26] culminating in the transcriptional induction of interferon-stimulated gene (ISGs). Therefore, IFNs generate diverse cellular and physiological outcomes involving antiviral, apoptotic, antiproliferative, antitumor, and immunomodulatory activities through ISGs [26].

Among the ISGs, interferon-alpha inducible protein 6 (IFI6), also known as G1P3, was first identified as an ISG and encodes three splice variants of 130–138 amino acids (~13 kDa) in human [2527].

IFI6 antagonizes apoptosis in a cellular context. In cancerous cells, IFI6 antagonizes intrinsic apoptosis via IFNs and TRAIL in myeloma cells and via 5-fluorouracil in gastric cancer cells [28,29]. Previous studies reported that IFI6 plays a crucial role in the pathogenesis of diverse malignant diseases, including myeloma and gastric and breast cancers [2729]. When IFI6 was overexpressed, preservation of mitochondrial membrane potential (ΔΨ) antagonized TRAIL-, IFNs-, and chemotherapeutic drug-induced intrinsic apoptosis. Although our understanding of its biological functions is limited, IFI6 has been characterized as a proliferative and anti-apoptotic factor in cancer cells [27,29]. Unlike in cancerous cells, IFI6 induces apoptosis in virus-infected cells.

IFI6 was found to be an ISG in chickens [26], and its differential expression in the joints of avian reovirus (ARV)-infected chickens was investigated, revealing that it plays a significant role in resistance against ARV infection [30]. In addition, chicken IFI6 (chIFI6) was identified as a differentially expressed ISG in embryos and the bursa of Fabricius of Newcastle disease virus (NDV)-infected chickens [31]. Also, IFI6 in chicken DF-1 cells causes apoptosis and inhibits NDV replication [32]. Nonetheless, with the exception of melanoma differentiation-associated gene 5 (MDA5), signaling mechanisms that regulate the expression of chIFI6 have not been investigated in chickens [33].

The purpose of this study was to examine the molecular properties of chIFI6 and compare the transcriptional profiles of HPAIV-infected chicken tissues, including the lungs, spleens, and tracheas. Furthermore, we investigated whether the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways play a role in the regulation of chIFI6 transcription in DF-1 cells in response to polyinosinic-polycytidylic acid (poly [I:C]; PIC), a synthetic TLR3 ligand.

MATERIALS AND METHODS

Chicken tissue collection

Specific pathogen-free White Leghorn chickens (4 weeks old) were purchased from the Poultry Research Centre of the National Institute of Animal Science (NIAS; Hanoi, Vietnam). The chickens had unlimited access to antibiotic-free feed and water. For HPAIV challenge, we used five of 4-week-old White Leghorn chickens per each group, and these chickens received intranasal inoculation with 200 µL of harvested allantois fluid from the infected eggs, containing 1 × 104 50% egg infectious dose (EID50) [30] of A/duck/Vietnam/QB1207/2012 (H5N1), according to the Office International des Épizooties (OIE) guidelines [34]. Tracheal, lung, and spleen tissues were collected from HPAIV- and mock-infected chickens, and stored at –70°C until RNA isolation. All experiments were conducted in compliance with the institutional rules for the care and use of laboratory animals, as well as implementing the protocol approved by the Ministry of Agriculture and Rural Development of Vietnam (TCVN 8402:2010 and TCVN 8400-26:2014).

Cell culture and regulation of toll- like receptor 3 signaling

DF-1 chicken fibroblast cell lines were obtained from the American Type Culture Collection (Rockville, MD, USA) and maintained in the Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum (FBS; Biowest, Nuaillé, France). DF-1 cells were cultured at 37°C in 5% CO2 incubator. PIC was purchased from InvivoGen (San Diego, CA, USA), stocked according to the manufacturer’s instructions, and maintained under the same culture conditions as DF-1 cells during PIC treatment.

DF-1 cells were then treated with PIC at doses of 0.1, 1, 5, and 10 µg/mL and incubated for 1, 3, and 6 h, respectively, to check both time- and dose-dependent effects. In addition, DF-1 cells were treated with an NF-κ B inhibitor before PIC treatment and the expression of IFI6 was examined. BAY 11–7085 (BAY, inhibitor of the transcription factor NF-κB) was purchased from Sigma-Aldrich (St. Louis, MO, USA). The inhibitors were treated on DF-1 cells with 5 μM BAY 11–7085, 3 h before treatment with 5 μg/mL PIC. SB203580 (p38 inhibitor), SP600125 (JNK inhibitor), and PD98059 (MEK inhibitor) were purchased from InvivoGen and MedChem Express (Monmouth Junction, NJ, USA), respectively. MEK inhibition was achieved by treating DF-1 cells with 10 μM PD98059 (MEK) for 18 h, followed by 6 h of stimulation with 5 μg/mL PIC. DF-1 cells were treated with 10 μM SB203580 for 1 h to block p38 MAPK, followed by 6 h of stimulation with 5 μg/mL PIC. JNK inhibition was achieved by treating DF-1 cells with 25 μM SP600125 for 1 h, followed by stimulation for 6 h with 5 μg/mL PIC.

RNA extraction and quantitative reverse transcription polymerase chain reaction

Total RNA was isolated from DF-1 cells and chicken tissues using the Pure-link MiniRNA Extraction Kit (Invitrogen, Carlsbad, CA, USA). For quantitative reverse transcription polymerase chain reaction (qRT-PCR), 1 µg of total RNA was used for cDNA synthesis with a ReverTra Ace-α first strand cDNA Synthesis Kit (Toyobo, Osaka, Japan). Sequence-specific primers (Table 1) were designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome). qRT-PCR was performed using the CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA, USA) and SYBR Green (Bio-Rad). Non-template wells without cDNA were used as negative controls. Each sample was tested in triplicates. The PCR conditions were 95°C for 3 min, followed by 40 cycles at 95°C for 10 s and 60°C for 30 s using a melting curve program (increasing the temperature from 65°C to 95°C at a rate of 0.5°C per 5 s and continuous fluorescence measurement). The qRT-PCR data were normalized relative to the expression of GAPDH and calculated using the 2-∆∆Ct method, where ∆∆Ct = (Ct of the target gene – Ct of GAPDH) treatment – (Ct of the target gene – Ct of GAPDH) control [35].

Table 1. Primer sequences for DF-1 chicken embryonic fibroblasts
Gene Sequence (5′ to 3′) Accession No. Temperature (℃) Product size (bp)
IFI6 F: GCCGGTTTCACTTCCTCTGG
R: CCCCCAAAGGATTTTGCCTC
NM_001001296.6 60 80
INF-α F: GACAGCCAACGCCAAAGC
R: GTCGCTGCTGTCCAAGCATT
NM_205427.1 60 342
IRF7 F: GAGGATCCGGCCAAATGGAA
R: CCAAATCGTGGTGGTTGAGC
NM_205372.2 60 211
GAPDH F: TGCTGCCCAGAACATCATCC
R: ACGGCAGGTCAGGTCAACAA
NM_204305.2 60 142

bp, base pair; IFI6, interferon-alpha inducible factor 6; IFN-α, interferon-alpha; IRF7, interferon regulatory factor 7; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Download Excel Table
Phylogenetic analysis

The amino acid sequences of IFI6 from various species, that is, cow (XP_010800843.1), humans (XP_024301975.1), horses (XP_023490948.1), pig (XP_020951317.1), cat (XP_019692026.1), dog (XP_535344.1), duck (XP_005027772.1), and chicken (NP_001001296.1) were retrieved from NCBI. Amino acids were then aligned using multiple sequence comparisons by log-expectation (MUSCLE) (http://www.ebi.ac.uk/Tools/msa/muscle/). Phylogenetic analysis was performed using the neighbor-joining method [21] with pairwise deletion, 1000 bootstrap replications, and Kimura 2, as described previously [22].

Statistical analysis

Both t-tests and analysis of variance (ANOVA) statistical tests were conducted to determine the significance levels. Data are shown as the mean ± standard deviation. Duncan’s multiple range tests followed by one-way ANOVA were used for comparison among different incubation times in each group.

RESULTS

Evolutionary analysis and string analysis of IFI6

Chicken IFI6(ENSGALG00000013575), duck IFI6(ENSAPLP00000010877), and quail IFI6(ENSCJPG00005007073) genes were found on chromosome 2 in chickens, ducks, and quail, respectively. Both chicken and duck IFI6genes have three exons, and complementary DNA sequences (cDNA) of chicken, duck, and quail IFI6genes are 1638, 495, and 324 base pairs, respectively (https://asia.ensembl.org/index.html). The IFI6 transcripts from chickens ( ENSGALT00000022096.4), ducks (ENSAPLT00000011595.2) and quails (ENSCJPT00005011937.1) encode 107 amino acids. Nucleotide sequence alignment revealed that chicken, duck, and quail IFI6genes shared 93.52% (chicken vs quail), 81.79% (duck vs chicken), 82.41% (duck vs quail) of nucleotide identity (Fig. 1A).

jast-65-1-183-g1
Fig. 1. Bioinformatics analysis of chicken and duck IFI6. (A) Nucleic acid sequences and amino acid sequences of chicken and duck IFI6. (B) Nucleic acid sequences alignment between chicken and duck IFI6 mRNAs. (C) Amino acid sequence alignment of chicken and duck IFI6 proteins. (D) Phylogenetic tree of IFI6 protein. The phylogenetic tree was analyzed with the full amino acid sequences of eight species by neighbor-joining method in Geneious program. IFI6, interferon-alpha inducible factor 6; If-i6-16 domain, interferon-induced protein 6-16 domain.
Download Original Figure

Amino acid sequence alignment revealed that chicken, duck, and quail IFI6 proteins shared 93.46% (chicken vs quail), 79.44% (duck vs chicken), 80.37% (duck vs quail) of nucleotide identity (Fig. 1B), respectively, showing that an IFI6/IFI27-like superfamily domain is conserved in chicken and duck IFI6 proteins (Fig. 1B). To investigate the evolutionary relationships of the chIFI6gene, we obtained cDNA sequences from nine species of vertebrates (chicken, duck, quail, human, cow, dog, horse, cat, and pig) from Ensembl 107 (https://asia.ensembl.org/index.html), and conducted a phylogenetic analysis (Fig. 1C). The results showed that chIFI6 is clustered in the same clade as quail and duck.

We retrieved single nucleotide variants of the chIFI6gene from the Ensembl genome browser.

As a result, 378 variants were retrieved, with six of them being identified in the exonic region.

Changes in the expression of chicken IFI6 and related genes in organs of highly pathogenic avian influenza virus-infected chickens

To confirm the differential expression of IFI6during HPAIV infection, qPCR was conducted in the lungs, spleens, and tracheas of HPAIV-infected chickens. The expression of IFI6was considerably higher in the tracheas (p < 0.001, Fig. 2A), spleen (p < 0.005, Fig. 2B), and lung (p < 0.005, Fig. 2C) of HPAIV-infected chickens than in control chickens. In addition, we analyzed the expression of HPAIV infection-related genes, IRF7and IFN-α which are known to be regulated by HPAIV infections. The expression of IRF7, a transcription factor that mediates TLR3 signaling in the nucleus, was dramatically elevated in the spleens and tracheas (p <0.001, Figs. 2A and 2B) of HPAIV-infected chickens, but not in the lungs (N.S., Fig. 2C). Notably, IFN-α expression was significantly elevated in the tracheas of HPAIV-infected chickens (p < 0.001, Fig. 2A), but decreased significantly in the lungs (p < 0.0001, Fig. 2C).

jast-65-1-183-g2
Fig. 2. Expression of chIFI6, IFN-α, and IRF7 in the tissues from highly pathogenic avian influenza virus (HPAIV)-infected White Leghorn chickens. IFI6, IFN-α, and IRF7 mRNA expression in the (A) tracheas, (B) spleens, and (C) lungs. The mRNA expression was measured using real-time PCR. The fold-change in mRNA was normalized to that of GAPDH mRNA. Data are expressed as the mean ± SD (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 calculated using unpaired two-tailed Student’s t-test. GAPDH, glyceraldehyde 3-phosphate dehydrogenas; IFI6, interferon-alpha inducible factor 6; IFN-α, interferon-alpha; IRF7, interferon regulatory factor 7; PCR, polymerase chain reaction.
Download Original Figure
Transcription of the chickenIFI6 in DF-1 chicken cells in response to a TLR3 ligand

To investigate the mechanisms underlying the transcriptional regulation of IFI6during TLR3-induced inflammation, we used DF-1 cells activated by PIC, as previously reported [36]. IFI6transcription was examined in a dose- and time-dependent manner to establish optimal conditions (Fig. 3). To determine the optimum dose, PIC doses of 0.1, 1, 5, and 10 μg/mL were tested. As a result, IFI6expression was significantly upregulated as the dose of PIC increased from 0.1 to 5 μg/mL (p < 0.001). However, IFI6expression was reduced with 10 μg/mL (p < 0.001, Fig. 3A). To determine the optimum treatment time, DF-1 cells were treated with 5 μg/mL PIC for 1, 3, and 6 h. IFI6 expression was considerably increased depending on the treatment time (p < 0.01, Fig. 3B). Furthermore, the expression of IFNα and IRF7significantly increased under these conditions (p < 0.0001, Fig. 3C).

jast-65-1-183-g3
Fig. 3. Transcription of chIFI6 gene in chicken DF-1 cells after PIC stimulation. IFI6 mRNA expression in chicken DF-1 fibroblasts was measured in a dose- (A) and time-dependent manner (B) of PIC. IFI6, IFN-α, and IRF7 mRNA expression in DF-1 cells stimulated with 5 µg/mL PIC for 6 h (C). The fold-change in mRNA was normalized to that of GAPDH mRNA. Data are expressed as the mean ± SD (n = 3). Statistical significance was determined using a one-way ANOVA. a-dDepict the result of statistical analysis (one-way ANOVA Duncan test); values followed by the same letter in a Duncan grouping are not significantly different; the subscript number and letter color correspond to the chart legend. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 calculated using unpaired two-tailed Student’s t-test. IFI6, interferon-alpha inducible factor 6; GAPDH, glyceraldehyde 3-phosphate dehydrogenas; IFN-α, interferon-alpha; IRF7, interferon regulatory factor 7; PIC, polyinosinic:polycytidylic acid (poly [I:C]).
Download Original Figure
Regulation of chicken IFI6 transcription through the NF-κB and MAPK signaling pathways in TLR3-stimulated DF-1 cells

To explore the role of NF-κB and MAPK signaling pathways in IFI6transcription in DF-1 cells that could be triggered by TLR3 stimulation, we used specific pharmacological inhibitors to block these pathways. TLR3-induced transcriptional activation of IFI6was greatly reduced by NF-κB and JNK inhibitors, but not by ERK and p38 inhibitors (Fig. 4). Inhibition of NF-κB and p38 MAPK pathways reduced IRF7expression, which was induced by TLR3activation (p <0.001, Figs. 4A and 4B), but not ERK and JNK (p < 0.1, Figs. 4C and 4D). TLR3-induced INF-α transcription was decreased by inhibiting the NF-κB pathway (p < 0.01, Fig. 4A), but not by inhibiting the MAPK pathways tested in this study ( p > 0.05, Figs. 4B, 4C, and 4D).

jast-65-1-183-g4
Fig. 4. Differential roles of NF-κB and MAPKs signaling pathways in chicken IFI6 transcription by PIC-stimulated DF-1 cells. IFI6, IFN-α, and IRF7 mRNA expression in PIC-stimulated DF-1 cells which were blocked by inhibitors; (A) BAY-7085, a NF-κB inhibitor, (B) SB203580, a p38 MAPK inhibitor, (C) SP600125, a JNK inhibitor, (D) PD98059, an ERK inhibitor. mRNA expression was measured using real-time PCR. mRNA fold-change was normalized to GAPDH mRNA. Statistical significance was measured using one-way ANOVA. a–dDepict the result of statistical analysis (one-way ANOVA Duncan test), values followed by the same letter in a Duncan grouping are not significantly different, the subscript number and letter color are corresponding to the chart legend. PIC, polyinosinic:polycytidylic acid (poly [I:C]); IFI6, interferon-alpha inducible factor 6; IFN-α, interferon-alpha; IRF7, interferon regulatory factor 7; PCR, polymerase chain reaction; GAPDH, glyceraldehyde 3-phosphate dehydrogenas.
Download Original Figure

DISCUSSION

In this study, we examined the molecular properties of chIFI6, such as nucleotide and amino acid sequence similarity, protein structure, and transcriptional patterns in HPAIV-infected lungs, spleens, and tracheas, as well as transcriptional regulation in chicken DF-1 cells in response to TLR3signalling.

Transcriptional profile analyses revealed that IFI6expression was upregulated in HPAIV-infected lungs, spleens, and tracheas, suggesting a role for IFI6 in pathogenesis, that includes apoptosis, caused by HPAIV infection.

Viruses are intracellular pathogens that can replicate within the cells of living hosts. Consequently, host systems for detecting viral infections and preventing viral replication have emerged. The antiviral response elicited by viral infection is multifaceted and involves the establishment of an antiviral transcriptional program including the synthesis of IFNs, cytokines, chemokines, and the activation of cell death pathways (apoptosis, necroptosis, and pyroptosis) [37]. Individually, these reactions provide notable benefits to the host during viral infections. Type I IFNs can limit viral replication by enhancing the expression of ISGs, which act against the viral life cycle [38]. Thus, ISGs induced by IFNs limit viral propagation in infected cells while promoting an antiviral state in uninfected cells in the surrounding environment [39]. Influenza viruses either inhibit apoptosis in infected cells to use the host cellular machinery for survival and safe replication [40,41], or accelerate cell death to achieve effective replication and transmission, resulting in morbidity [42,43]. Inhibition of cell death by influenza virus A infection is mediated by activation of the phosphatidylinositol 3-kinase (PI3K)/Akt pathway through direct binding of viral nonstructural protein 1 (NS1) to PI3K, resulting in inhibition of the activity of caspase 9 and glycogen synthase kinase-3 beta [41]. These findings also revealed that PI3K activation confers virus-supporting activity during intermediate stages of the infection cycle; however, influenza viruses can cause massive host cell death in order to replicate and transmit effectively, resulting in morbidity, pathogenicity, and virulence [42,43].

We investigated molecular features of IFI6 in chicken, duck, and quail using genomics data from Ensembl107. As a result, we discovered that nucleotide and amino acid sequences are highly conserved among the avian species studied in this study. A IF6/IFI27 domain, which is unique to FAM14 family member proteins, is also conserved. These findings suggest that the role of IFI6 in infectious disease pathogenesis, as well as the signaling pathway that regulates IFI6transcription, may be conserved, at least in the avian species studied in this study. More research is needed to uncover IFI6’s conserved function and its transcriptional regulation by signaling pathways such as NF-κB and MAPK, and other. In addition, variants of the chIFI6 gene from various chicken breeds that are resistant or susceptible to HPAIV infection will aid in the development of reliable molecular markers for molecular breeding or genomic selection.

In this study, we also discovered that both HPAIV infection and TLR3activation increased IFI6expression (Figs. 2 and 3C). Previous studies have found that viral infections regulate IFI6expression and play a role in viral pathogenesis [44,45]. IFI6expression increased in response to infectious bursal disease virus (IBCV) infection in a previous study [44]. The expression of IFI6induced by dengue virus (DENV) has been previously studied [45]. In another study, IFI6, an ER-localized integral membrane effector, was shown to prevent virus-induced ER membrane formation by controlling some flavivirus infections [46]. Furthermore, a previous study on influenza A virus found that the virus increases IFI6expression in infected cells at 3–18 h timepoints [47]. Nonetheless, the role of IFI6 as an ISG in the pathogenesis of HPAIV infection requires further investigation. Notably, IFI6 overexpression promoted cell apoptosis via a mitochondria-dependent pathway and inhibited in vitroreplication of NDV [32]. In the same study [32], IFI6 protein was found to be localized in the mitochondria, whereas Bax, a pro-apoptotic protein that causes irreversible loss of mitochondrial function, was found to be localized in the cytoplasm. Transcriptional analysis has revealed that genes encoding pro-apoptotic factors (Bax, Bak, Cyt c, caspase-3, and caspase-9) were significantly upregulated in cells overexpressing IFI6, whereas those encoding the anti-apoptotic markers Bcl-2 and Bcl-xl were significantly downregulated [32].

In a previous study, we performed comparative gene expression analyses in PIC-stimulated DF-1 cells [36], which demonstrated that, in chicken DF-1 cells, PIC treatment induces TLR3 signaling cascades to control the target genes from TLRs to proinflammatory transcription factors, cytokines, and type I interferon genes [36]. In these cells, the detection of double-stranded RNAs as ligands triggers various signaling cascades from the endosome to the nucleus, controlling the expression of the target gene. The NF-κB, MAPK, and IRF pathways are among these triggered signaling cascades. In this study, we investigated the transcriptional regulation of chIFI6in DF-1 cells, which was specifically inhibited by NF-κB and MAPK inhibitors. We discovered that NF-κB and JNK were required for TLR3-mediated transcriptional regulation of the chIFI6, whereas ERK and p38 MAPKs were not essential (Fig. 4). TLR3-induced IFN-α expression was unaffected by ERK, JNK, or p38 MAPK inhibition, but influenced by NF-κB inhibition, suggesting that the NF-κB pathway is essential for regulating the transcription of this gene by TLR3 signaling. TLR3-mediated transcriptional regulation of IRF7 is inhibited by suppression of NF-κB and p38 MAPK. These findings imply that the NF-κB pathway is required for the transcriptional regulation of IFI6, IFN-α, and IRF7in DF-1 cells, and that MAPK pathways play a different role in the transcriptional regulation of the genes investigated in this study. Further research into the molecular mechanisms underlying the transcriptional control of chIFI6is warranted.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This work was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education(2021R1I1A3057071)", the "Cooperative Research Program for Agriculture Science and Technology Development" (Project No. PJ015612), Rural Development Administration, Republic of Korea, and Research Base Construction Fund Support Program funded by Jeonbuk National University in 2021.

Acknowledgements

Not applicable.

Availability of data and material

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Authors’ contributions

Conceptualization: Song KD.

Methodology: Ndimukaga M, Tran HTT.

Investigation: Park JW, Ndimukaga M, So J,

Kim S, Truong AD, Dang HV, Song KD.

Writing - original draft: Park JW, Ndimukaga M.

Writing - review & editing: Park JW,

Ndimukaga M, So J, Kim S, Truong AD,

Tran HTT, Dang HV, Song KD.

Ethics approval and consent to participate

This work approved by the Ministry of Agriculture and Rural Development of Vietnam (TCVN 8402:2010 and TCVN 8400- 26:2014).

REFERENCES

1.

Spickler AR, Trampel DW, Roth JA. The onset of virus shedding and clinical signs in chickens infected with high-pathogenicity and low-pathogenicity avian influenza viruses. Avian Pathol. 2008; 37:555-77

2.

Alexander DJ. A review of avian influenza in different bird species. Vet Microbiol. 2000; 74:3-13

3.

Horimoto T, Kawaoka Y. Pandemic threat posed by avian influenza A viruses. Clin Microbiol Rev. 2001; 14:129-49

4.

Mo IP, Brugh M, Fletcher OJ, Rowland GN, Swayne DE. Comparative pathology of chickens experimentally inoculated with avian influenza viruses of low and high pathogenicity. Avian Dis. 1997; 41:125-36

5.

Michaelis M, Geiler J, Klassert D, Doerr HW, Cinatl J. Infection of human retinal pigment epithelial cells with influenza A viruses. Invest Ophthalmol Vis Sci. 2009; 50:5419-25

6.

Xing Z, Harper R, Anunciacion J, Yang Z, Gao W, Qu B, et al. Host immune and apoptotic responses to avian influenza virus H9N2 in human tracheobronchial epithelial cells. Am J Respir Cell Mol Biol. 2011; 44:24-33

7.

Zeng H, Pappas C, Katz JM, Tumpey TM. The 2009 pandemic H1N1 and triple-reassortant swine H1N1 influenza viruses replicate efficiently but elicit an attenuated inflammatory response in polarized human bronchial epithelial cells. J Virol. 2011; 85:686-96

8.

Qu B, Li X, Gao W, Sun W, Jin Y, Cardona CJ, et al. Human intestinal epithelial cells are susceptible to influenza virus subtype H9N2. Virus Res. 2012; 163:151-9

9.

Yang N, Hong X, Yang P, Ju X, Wang Y, Tang J, et al. The 2009 pandemic A/Wenshan/01/2009 H1N1 induces apoptotic cell death in human airway epithelial cells. J Mol Cell Biol. 2011; 3:221-9

10.

Daidoji T, Koma T, Du A, Yang CS, Ueda M, Ikuta K, et al. H5N1 avian influenza virus induces apoptotic cell death in mammalian airway epithelial cells. J Virol. 2008; 82:11294-307

11.

Mao H, Tu W, Qin G, Law HKW, Sia SF, Chan PL, et al. Influenza virus directly infects human natural killer cells and induces cell apoptosis. J Virol. 2009; 83:9215-22

12.

Wong CNA. Analysis of influenza viral cytopathic effect in human lower respiratory tract. [Master’s thesis]. Pokfulam, Hong Kong: University of Hong Kong. 2008

13.

Takizawa T, Matsukawa S, Higuchi Y, Nakamura S, Nakanishi Y, Fukuda R. Induction of programmed cell death (apoptosis) by influenza virus infection in tissue culture cells. J Gen Virol. 1993; 74:2347-55

14.

Hinshaw VS, Olsen CW, Dybdahl-Sissoko N, Evans D. Apoptosis: a mechanism of cell killing by influenza A and B viruses. J Virol. 1994; 68:3667-73

15.

Fesq H, Bacher M, Nain M, Gemsa D. Programmed cell death (apoptosis) in human monocytes infected by influenza A virus. Immunobiology. 1994; 190:175-82

16.

Mok CKP, Lee DCW, Cheung CY, Peiris M, Lau ASY. Differential onset of apoptosis in influenza A virus H5N1- and H1N1-infected human blood macrophages. J Gen Virol. 2007; 88:1275-80

17.

Mori I, Komatsu T, Takeuchi K, Nakakuki K, Sudo M, Kimura Y, et al. In vivo induction of apoptosis by influenza virus. J Gen Virol. 1995; 76:2869-73

18.

Zhou J, Law HKW, Cheung CY, Ng IHY, Peiris JSM, Lau YL. Functional tumor necrosis factor-related apoptosis-inducing ligand production by avian influenza virus-infected macrophages. J Infect Dis. 2006; 193:945-53

19.

Gerlach RL, Camp JV, Chu YK, Jonsson CB. Early host responses of seasonal and pandemic influenza A viruses in primary well-differentiated human lung epithelial cells. PLOS ONE. 2013; 8e78912

20.

Long JP, Kotur MS, Stark GV, Warren RL, Kasoji M, Craft JL, et al. Accumulation of CD11b+Gr-1+ cells in the lung, blood and bone marrow of mice infected with highly pathogenic H5N1 and H1N1 influenza viruses. Arch Virol. 2013; 158:1305-22

21.

Iwasaki A, Pillai PS. Innate immunity to influenza virus infection. Nat Rev Immunol. 2014; 14:315-28

22.

Moraga I, Harari D, Schreiber G, Uzé G, Pellegrini S. Receptor density is key to the alpha2/beta interferon differential activities. Mol Cell Biol. 2009; 29:4778-87

23.

Isaacs A, Lindenmann J. Virus interference. I. The interferon. Proc R Soc B Biol Sci. 1957; 147:258-67

24.

Wheelock EF. Interferon-like virus-inhibitor induced in human leukocytes by phytohemagglutinin. Science. 1965; 149:310-1

25.

Sato M, Taniguchi T, Tanaka N. The interferon system and interferon regulatory factor transcription factors – studies from gene knockout mice. Cytokine Growth Factor Rev. 2001; 12:133-42

26.

Parker N, Porter ACG. Identification of a novel gene family that includes the interferon-inducible human genes 6-16 and ISG12. BMC Genomics. 2004; 5:8

27.

Cheriyath V, Glaser KB, Waring JF, Baz R, Hussein MA, Borden EC. G1P3, an IFN-induced survival factor, antagonizes TRAIL-induced apoptosis in human myeloma cells. J Clin Invest. 2007; 117:3107-17

28.

Tahara E, Tahara H, Kanno M, Naka K, Takeda Y, Matsuzaki T, et al. G1P3, an interferon inducible gene 6-16, is expressed in gastric cancers and inhibits mitochondrial-mediated apoptosis in gastric cancer cell line TMK-1 cell. Cancer Immunol Immunother. 2005; 54:729-40

29.

Cheriyath V, Kuhns MA, Jacobs BS, Evangelista P, Elson P, Downs-Kelly E, et al. G1P3, an interferon- and estrogen-induced survival protein contributes to hyperplasia, tamoxifen resistance and poor outcomes in breast cancer. Oncogene. 2012; 31:2222-36

30.

Wang S, Xie L, Xie Z, Wan L, Huang J, Deng X, et al. Dynamic changes in the expression of interferon-stimulated genes in joints of SPF chickens infected with Avian Reovirus. Front Vet Sci. 2021; 8:618124

31.

Jia YQ, Wang XL, Wang XW, Yan CQ, Lv CJ, Li XQ, et al. Common microRNA-mRNA interactions in different newcastle disease virus-infected chicken embryonic visceral tissues. Int J Mol Sci. 2018; 19:1291

32.

Li X, Jia Y, Liu H, Wang X, Chu Z, Hu R, et al. High level expression of ISG12(1) promotes cell apoptosis via mitochondrial-dependent pathway and so as to hinder Newcastle disease virus replication. Vet Microbiol. 2019; 228:147-56

33.

Yu S, Mao H, Jin M, Lin X. Transcriptomic analysis of the chicken MDA5 response genes. Genes. 2020; 11:308

34.

Huprikar J, Rabinowitz S. A simplified plaque assay for influenza viruses in Madin-Darby kidney (MDCK) cells. J Virol Methods. 1980; 1:117-20

35.

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001; 25:402-8

36.

Jang HJ, Song KD. Expression patterns of innate immunity-related genes in response to polyinosinic:polycytidylic acid (poly[I:C]) stimulation in DF-1 chicken fibroblast cells. J Anim Sci Technol. 2020; 62:385-95

37.

Chow J, Franz KM, Kagan JC. PRRs are watching you: localization of innate sensing and signaling regulators. Virology. 2015; 479-80:104-9

38.

Schoggins JW. Interferon-stimulated genes: roles in viral pathogenesis. Curr Opin Virol. 2014; 6:40-6

39.

Orzalli MH, Kagan JC. Apoptosis and necroptosis as host defense strategies to prevent viral infection. Trends Cell Biol. 2017; 27:800-9

40.

Zhirnov OP, Konakova TE, Wolff T, Klenk HD. NS1 protein of influenza a virus down-regulates apoptosis. J Virol. 2002; 76:1617-25

41.

Ehrhardt C, Wolff T, Pleschka S, Planz O, Beermann W, Bode JG, et al. Influenza A virus NS1 protein activates the PI3K/Akt pathway to mediate antiapoptotic signaling responses. J Virol. 2007; 81:3058-67

42.

Brydon EWA, Morris SJ, Sweet C. Role of apoptosis and cytokines in influenza virus morbidity. FEMS Microbiol Rev. 2005; 29:837-50

43.

Ludwig S, Pleschka S, Planz O, Wolff T. Ringing the alarm bells: signalling and apoptosis in influenza virus infected cells. Cell Microbiol. 2006; 8:375-86

44.

Yu Y, Xu Z, Liu Y, Zhang H, Ou C, Zhang Y, et al. Effects of infectious bursal disease virus infection on interferon and antiviral gene expression in layer chicken bursa. Microb Pathog. 2020; 144:104182

45.

Qi Y, Li Y, Zhang Y, Zhang L, Wang Z, Zhang X, et al. IFI6 inhibits apoptosis via mitochondrial-dependent pathway in dengue virus 2 infected vascular endothelial cells. PLOS ONE. 2015; 10(8)e0132743

46.

Richardson RB, Ohlson MB, Eitson JL, Kumar A, McDougal MB, Boys IN, et al. A CRISPR screen identifies IFI6 as an ER-resident interferon effector that blocks flavivirus replication. Nat Microbiol. 2018; 3:1214-23

47.

Cao Y, Huang Y, Xu K, Liu Y, Li X, Xu Y, et al. Differential responses of innate immunity triggered by different subtypes of influenza a viruses in human and avian hosts. BMC Med Genomics. 2017; 10:70

PDF Download
PubReader
Export Citation
Email the Author

Metrics

View
9,883
Download
2,229
Crossref
6
Scopus
5

QR Code of this Article:



Related Articles

Transcriptomic Signatures of Chicken DF-1 Cells Following Toll-Like Receptor 3 Stimulation
J Anim Sci Technol 2026 [published online ahead of print: Apr 23, 2026]




Revised Publication Charge


(Effective for articles submitted beginning January 1, 2026)

The publication charge is 1,500,000 Korean Won per article for members of the Korean Society of Animal Science and Technology (KSAST), and 2,000,000 Korean Won for non-members. First and corresponding authors are required to pay the annual membership fee.

The publication charge for a corresponding author outside Korea is 1,500 US dollars per article.


I don't want to open this window for a day.