RESEARCH ARTICLE

Development of functional fermented feed additives enhanced with xylo-oligosaccharides and yeast proteins from corn cobs

Gayoung Lee1https://orcid.org/0009-0000-5761-4896, In Jung Kim2,*https://orcid.org/0000-0001-6109-8492, Soo Rin Kim1,3,*https://orcid.org/0000-0001-5855-643X
Author Information & Copyright
1School of Food Science and Biotechnology, Kyungpook National University, Daegu 41566, Korea
2Department of Food Science and Technology, Institute of Agriculture and Life Science, Gyeongsang National University, Jinju 52828, Korea
3Research Institute of Tailored Food Technology, Kyungpook National University, Daegu 41566, Korea
*Corresponding author: In Jung Kim, Department of Food Science and Technology, Institute of Agriculture and Life Science, Gyeongsang National University, Jinju 52828, Korea., Tel: +82-55-772-1905, E-mail: ij0308@gnu.ac.kr
*Corresponding author: Soo Rin Kim, School of Food Science and Biotechnology, Kyungpook National University, Daegu 41566, Korea., Tel: +82-53-950-7769, E-mail: soorinkim@knu.ac.kr

© Copyright 2025 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Jan 09, 2025; Revised: Feb 25, 2025; Accepted: Feb 27, 2025

Published Online: Nov 30, 2025

Abstract

The use of agricultural by-products, such as corn cobs, has gained significant attention as a sustainable and promising strategy for developing functional feed additives. This study aimed to produce a functional feed additive enriched with xylo-oligosaccharides (XOS) and yeast protein, using corn cobs as the primary raw material. To efficiently convert the xylan in corn cobs into XOS, a recombinant Saccharomyces boulardii strain displaying endo-xylanase on its cell surface was constructed. Among six anchor proteins evaluated for their efficiency in endo-xylanase expression, the X-Tir1 strain exhibited the highest enzymatic activity. Simultaneous saccharification and fermentation of pretreated corn cobs using the X-Tir1 strain and commercial cellulase were optimized under various pretreatment conditions, resulting in the production of 15.2 g/L of XOS and 12.8 g DCW/L of yeast protein after 72 h of fermentation with corn cobs pretreated using 2% (w/v) NaOH. This study demonstrates an environmentally sustainable and cost-effective approach to upcycling agricultural by-products into value-added functional feed additives, thereby improving feed efficiency in fiber-based diets. Additionally, it underscores the applicability of a cell surface display system as a versatile and effective tool for bioconversion processes.

Keywords: Xylo-oligosaccharide; Yeast protein; Corn cob; Cell surface display system; Endo-xylanase; Simultaneous saccharification and fermentation

INTRODUCTION

The global demand for functional animal feed additives is increasing rapidly, driven by the need to enhance animal health and promote agricultural sustainability [1]. High-calorie grain-based diets, commonly used to improve feed efficiency in livestock, have been associated with issues such as immune disorders and Escherichia coli O157 infections in cattle [2]. Furthermore, the rising costs of grain imports, which constitute a significant portion of feed expenses worldwide, underscore the urgent need for alternative solutions [3,4]. Consequently, developing feed additives that can reduce grain dependency while enhancing nutritional value and feed efficiency, particularly in fiber-based diets, has emerged as a pressing priority [5].

Xylo-oligosaccharides (XOS) are well-established functional oligosaccharides that act as prebiotics, promoting the growth of beneficial gut bacteria such as Bifidobacterium and Lactobacillus, thereby improving gut health, enhancing immune function, and increasing digestive efficiency in animals [6]. XOS can be derived from xylan, a dietary fiber, through the action of endo-xylanase [7]. Similarly, yeast protein, rich in vitamin B and high-quality protein, serves as a valuable nutritional source, contributing to disease prevention, metabolic balance, and improved feed efficiency [8]. The inclusion of XOS and yeast protein in feed additives not only enhances their nutritional value and feed efficiency but also provides a sustainable and cost-effective alternative to expensive antibiotics and protein supplements.

Corn cobs are a major by-product of corn production, with millions of tons discarded annually [9]. They consist of 30%–40% hemicellulose, 35%–45% cellulose, and 5%–20% lignin, with a notably high content of xylan-based hemicellulose (35%–40%). This composition makes corn cobs a promising lignocellulosic biomass resource for producing high-value products such as XOS [10]. Globally, there is a growing interest in utilizing agricultural residues as renewable resources for food and biofuels. Corn cobs are relatively inexpensive and widely available, positioning them as an ideal raw material for developing sustainable feed additives [6]. Furthermore, while corn cobs contain various nutrients, such as beta-sitosterol and minerals, their digestibility is low when fed directly to animals. As a result, microbial fermentation of corn cobs to produce feed presents an effective alternative [11].

Although advancements have been made in the production of XOS and yeast protein from lignocellulosic biomass, several challenges remain. Conventional methods often rely on extensive chemical treatments or multi-step enzymatic processes, which are complex, costly, and associated with significant environmental impacts [12]. Some studies have successfully produced XOS and yeast protein using reed sawdust as a substrate; however, these processes remain complex, as XOS and yeast protein are produced separately [13]. This underscores the need for simplified and environmentally sustainable approaches to produce XOS and yeast protein using agricultural by-products simultaneously.

This study aimed to develop an integrated and environmentally sustainable process for producing a functional feed additive enriched with XOS and yeast protein from corn cobs. To achieve efficient XOS production, a recombinant Saccharomyces boulardii strain expressing the endo-xylanase gene on its cell surface was employed. A simultaneous saccharification and fermentation (SSF) process was conducted using pretreated corn cobs under various conditions, combining the recombinant strain with commercial cellulase. This process enabled the concurrent production of XOS and yeast protein by efficiently utilizing the xylan and cellulose present in corn cobs. To the best of our knowledge, this study represents the first successful attempt to simultaneously produce XOS and yeast protein using a recombinant S. boulardii strain engineered to express endo-xylanase on its cell surface. This innovative approach highlights the potential for developing cost-effective and environmentally sustainable functional feed additives by repurposing agricultural residues. Furthermore, this strategy aims to enhance the nutritional value and digestibility of fiber-based diets, thereby providing a robust foundation for the development of sustainable feed solutions that reduce dependence on grain-based feed.

MATERIALS AND METHODS

Chemicals and materials

Corn cobs were obtained from Tojongherb and used as the substrate for an integrated process to produce XOS and yeast protein. A commercial cellulase (Cellic® Ctec3) was purchased from Novozymes and used to hydrolyze the residual cellulose in the pretreated corn cob into glucose, which served as a nutrient source for yeast growth. Glucose and xylose (X1) were procured from Sigma-Aldrich. Beechwood xylan, xylobiose (X2), xylotriose (X3), xylotetraose (X4), xylopentaose (X5) and xylohexaose (X6) were obtained from Megazyme.

Strain and growth conditions

The recombinant yeast strains and plasmids used in this study are detailed in Table 1. Yeast cells were pre-cultivated in yeast extract and peptone (YP) medium (10 g/L yeast extract and 20 g/L peptone) supplemented with 20 g/L dextrose (YPD). The pre-cultivation was performed at 30°C and 250 rpm for 24 h, after which the cells were used in subsequent experiments. E. coli DH5α (New England Biolabs) was used for amplifying gRNA plasmids. E. coli cells were cultivated in luria-bertani (LB) medium (5 g/L yeast extract, 10 g/L tryptone, 10 g/L NaCl) supplemented with 100 μg/mL ampicillin (LBA). Cultivation was conducted at 37°C and 250 rpm for 18 h.

Table 1. Yeast strains and plasmids used in this study
Strains Description1) References
Saccharomyces boulardii
 SB Wild-type; Saccharomyces boulardii (ATCC MYA-796) [33]
 X-Aga2 SB int#1::PCCW12-MFα1-TsaGH11-AGA2- TCYC1 This study
 X-Cwp1 SB int#1::PCCW12-MFα1- TsaGH11-CWP1- TCYC1 This study
 X-Cwp2 SB int#1::PCCW12-MFα1- TsaGH11-CWP2- TCYC1 This study
 X-Sed1 SB int#1::PCCW12-MFα1- TsaGH11-SED1- TCYC1 This study
 X-Pir1 SB int#1::PCCW12-MFα1- TsaGH11-PIR1- TCYC1 This study
 X-Tir1 SB int#1::PCCW12-MFα1- TsaGH11-TIR1- TCYC1 This study
Plasmids
 pRS41N-Cas9 pRS41N plasmid containing a natNT marker and Cas9 [46]
 pRS42H-cg#1 pRS42H plasmid containing a hph marker and gRNA for the cg#1 site [47]

1) TsaGH11 is a codon optimized TsaGH11 gene derived from Thermoanaerobacterium saccharolyticum; anchor protein genes (AGA2, CWP1, CWP2, SED1, PIR1, TIR1) were derived from Saccharomyces boulardii.

Download Excel Table
Strain construction

The yeast transformation process followed a previous study [14,15], with the following modifications applied in this study (Table 2). To construct expression cassettes for endo-xylanase, the TsaGH11 gene (UniProt: I3VTR8) from Thermoanaerobacterium saccharolyticum was codon-optimized for E. coli [16]. The endo-xylanase gene, fused with six different anchor protein genes derived from S. boulardii, was integrated into the cg#1 sequence of the S. boulardiiPCCW12-MFα1-cg#1-TCYC1 strain, which had been previously constructed [15], using the pRS42H-cg#1 gRNA plasmid. Finally, six strains expressing endo-xylanase with different anchor proteins, X-Aga2, X-Cwp1, X-Cwp2, X-Sed1, X-Pir1, and X-Tir1, were constructed (Fig. 1A).

Table 2. Primers used in this study
Primers Sequences (5’-) Description
Kim1697 GGGTATCTTTGGATAAAAGAGAGGCTGAAGCT GACACCACGAACTATTGGC TsaGH11-F
kim1939 GAGGGGATTTGCTCGCATATAGTTGTCAGTTCCTG CCATACAGTGACGTTTGCG TsaGH11_AGA2_R
kim1940 GTATTGTATATCCGAGCCGGAACGGATACTCACCAG CCATACAGTGACGTTTGCG TsaGH11_CWP1_R
kim1941 GTAGCTTGGATTTGACCGTCAGTGATTTGAGAAAT CCATACAGTGACGTTTGCG TsaGH11_CWP2_R
kim1942 GGATTTGACCGTCACCAATTTGAGAGATAGCAGC CCATACAGTGACGTTTGCG TsaGH11_PIR1_R
kim1943 GAGCTTCAGTAGAAGTACCGTTAGTTGGAAGAGC CCATACAGTGACGTTTGCG TsaGH11_SED1_R
kim1944 GGAAAATCCAGAGGAAGAATCAGAAGCTAAGCT CCATACAGTGACGTTTGCG TsaGH11_TIR1_R
GY1 GGCTATCAGAGCTCTGGTTACGCAAACGTCACTGTATGG CAGGAACTGACAACTATATG AGA2_F
JA8 Gagggcgtgaatgtaagcgtgacataactaattacatgatca TCAAAAAACATACTGTGTGTTTATGGG AGA2_R
GY2 GGCTATCAGAGCTCTGGTTACGCAAACGTCACTGTATGG CTGGTGAGTATCCGTTCC CWP1_F
JA10 GAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATCA TTACAACAAGTAAGCAGCTG CWP1_R
GY3 GGCTATCAGAGCTCTGGTTACGCAAACGTCACTGTATGG ATTTCTCAAATCACTGACG CWP2_F
JA12 GAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATCA TTATAACAACATAGCAGCAGC CWP2_R
GY4 GGCTATCAGAGCTCTGGTTACGCAAACGTCACTGTATGG GCTGCTATCTCTCAAATTGG PIR1_F
JA14 GAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATCA TTAACAGTTGACCAAGTCGATAG PIR1_R
GY5 GGCTATCAGAGCTCTGGTTACGCAAACGTCACTGTATGG GCTCTTCCAACTAACGGTAC SED1_F
JA16 GAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATCA TTATAAGAATAACATAGCAACACCAG SED1_R
GY6 GGCTATCAGAGCTCTGGTTACGCAAACGTCACTGTATGG AGCTTAGCTTCTGATTCTTC TIR1_F
JA24 GAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATCA TTATAACAACATAGCGGCAGCTG TIR1_R
gRNA Sequences (5’-) + PAM site
cg#1 GTACACCTACCCGTCACCGG AGG pRS42H-cg#1
Download Excel Table
jast-67-6-1379-g1
Fig. 1. Development of yeast displaying endo-xylanase and the corn cob fermentation process. (A) Expression cassette for the display of endo-xylanase on the yeast cell surface via a CRISPR-Cas9 genome integration strategy. P, promoter; T, terminator; Mfα1, α-mating factor signal peptide derived from Saccharomyces cerevisiae; TsaGH11, gene encoding GH11 family endo-xylanase from Thermoanaerobacterium saccharolyticum and codon-optimized to Escherichia coli; AGA2, CWP1, CWP2, SED1, PIR1, TIR1: anchor protein genes derived from S. boulardii. (B) Schematic representation of XOS and yeast protein production from corn cobs. XOS: xylo-oligosaccharides; SSF: simultaneous saccharification and fermentation.
Download Original Figure
Enzyme assays

To compare the enzymatic activity of endo-xylanase anchored on the cell surface, the experiment was conducted under the following conditions, using the methodology described by Kim et al. [16] with modifications: Cells were cultivated in YP medium supplemented with 20 g/L glucose (YPD) until reaching an exponential-phase cell density of 0.5 g DCW/L. The cells were then harvested by centrifugation at 3,500×g for 5 min and washed twice with sterile distilled water. The experiment was conducted with a cell concentration of 20 g DCW/L in a reaction mixture containing 0.5% (w/v) beechwood xylan as the substrate and 50 mM sodium acetate buffer (pH 5.0) in a total reaction volume of 1,000 µL. The reaction was carried out at 30°C and 130 rpm for 30 min. To terminate the reaction, the cells were centrifuged at 20,000×g for 1 min, and a 40 μL aliquot was taken. The enzyme reaction was halted by adding 80 μL of 3,5-dinitrosalicylic acid (DNS) reagent, followed by heating at 95°C for 5 min to allow color development. After centrifugation at 20,000×g for 10 min at 25°C, 100 μL of the supernatant containing the released sugars was collected, and absorbance was measured at 540 nm using a SpectraMax Pro iD3 microplate reader (Molecular Devices). All experiments were performed in biological triplicates.

Beechwood xylan fermentation

Fermentation was performed in a 100-mL flask containing 20 mL of YP medium supplemented with 20 g/L glucose and 20 g/L xylan solution (YPDX) at 30°C and 130 rpm. The initial optical density (OD) was adjusted to 1. All experiments were performed in biological triplicates.

Pretreatment of corn cobs

Corn cobs were ground into particles smaller than 1.00 mm using a mechanical grinder. For pretreatment, 5 g of the ground powder was mixed with 45 mL of one of the following solutions: distilled water (DW), 1% (w/v) sulfuric acid (H₂SO₄), 2% (w/v) sodium hydroxide (NaOH), 7% (w/v) NaOH, or 12% (w/v) NaOH solution, maintaining a solid loading of 10%. The mixtures were subjected to thermal treatment at 121°C for 20 min. Following heat treatment, the pH was adjusted to 6.5 by adding 12 N hydrochloric acid (HCl) to neutralize the samples.

The neutralized samples were centrifuged at 3,500×g for 20 min to recover the solid fractions, and the supernatant was discarded. The recovered solid fractions were subjected to lyophilization and used in subsequent fermentation experiments (Fig. 1B).

Simultaneous saccharification and fermentation

The pretreated corn cobs were subjected to SSF using the previously selected X-Tir1 strain and a commercial cellulase. Fermentation was initiated by adding the X-Tir1 strain and Cellic® CTec3 cellulase (3% v/v; mL-Cellic® CTec3/g-biomass) to a YP medium (15 g/L yeast extract, 30 g/L peptone) containing the pretreated corn cobs at a 10% (w/v) solid loading. The initial OD was adjusted to 10, and the fermentation was conducted in a 50 mL flask with a working volume of 10 mL. The process was carried out at 30°C and 250 rpm (Fig. 1B). All experiments were performed in biological triplicates.

Analytical methods

To quantify metabolic products, including XOS, xylose, and glucose, fermentation products were collected at 24-h intervals. Collected samples were centrifuged at 20,000×g for 10 min. The supernatant was filtered through a 0.22 μm PES filter and analyzed using a high-performance liquid chromatography (HPLC) device equipped with a refractive index (RI) detector (Agilent Technologies) and a Shodex KS-802 column (Resonac). The column was eluted with HPLC-grade water at a flow rate of 0.5 mL/min at 80°C, with an injection volume of 10 μL. Cell density was measured at 600 nm (OD600) using a UV/Vis spectrophotometer (Hangzhou Allsheng Instruments).

Yeast cell counting and dry cell weight

Cell counting was performed using a counting chamber (Marienfeld-Superior) under 200× magnification on an OLYMPUS BX43 microscope. Samples were diluted with sterile distilled water, and cells were manually enumerated. For each count, cells within five 0.2 × 0.2 mm squares (four quadrants and the center) were counted.

The dry cell weight (DCW) was determined based on the relationship between OD and cell concentration, where an OD of 1.0 at 600 nm corresponds to 3 × 107 cells/mL, which is equivalent to 0.26 g dry cell/L, as determined using a laboratory spectrophotometer.

Characterization of corn cobs and mass balance of the process

The composition of neutral detergent fiber (NDF), acid detergent fiber (ADF), and lignin were analyzed for raw corn cobs and corn cobs pretreated with 2% NaOH. These analyses were conducted at the Institute of Agricultural Science, Chungnam National University, following standard Association of Official Analytical Chemists (AOAC) methods. All measurements were performed in duplicate. Hemicellulose content was calculated as the difference between NDF and ADF, and cellulose content was derived by subtracting lignin from ADF. The mass balance of the process was calculated based on the composition of cellulose, hemicellulose, and lignin in the corn cobs, as well as the products derived from these components.

Statistical analysis

All statistical analyses were performed using IBM SPSS Statistics software ver. 27 (IBM). Data were subjected to one-way analysis of variance (ANOVA) to evaluate differences among treatment groups. Tukey’s honestly significant difference (HSD) test was used for post-hoc comparisons at a significance level of p < 0.05.

RESULTS

Construction of recombinant Saccharomyces boulardii with Endo-xylanase immobilized on the cell surface

Xylanase, an enzyme from the glycoside hydrolase (GH) family, is capable of cleaving the β-1,4-glycosidic bonds in the xylan backbone. Among these, endo-type GH11 enzymes specifically target xylan substrates rather than cellulose and can be used to produce various types of XOS. In this study, a cell surface display system was employed to immobilize the GH11 family endo-xylanase (TsaGH11) derived from T. saccharolyticum on the yeast cell surface, facilitating the efficient production of XOS and yeast protein [12,16].

To immobilize the enzyme on the yeast cell surface, the enzyme must first be transported through the endoplasmic reticulum and Golgi apparatus to the plasma membrane via a secretion protein. After being directed to the cell wall by a signal peptide, the enzyme requires an anchor protein to prevent its release into the extracellular space and ensure its retention on the cell surface (Fig. 2). Therefore, the expression of a signal peptide, target protein, and anchor protein is essential for effective enzyme immobilization on the cell surface. In this study, MFα1 (α-factor preproleader sequence), a widely used signal peptide, was utilized [17]. Additionally, six anchor proteins were tested to identify the optimal anchor protein for endo-xylanase expression [18,19].

jast-67-6-1379-g2
Fig. 2. Strategies for producing XOS using whole-cell biocatalyst expressing endo-xylanase on the yeast cell surface. This schematic diagram illustrates how endo-xylanase is anchored to the yeast cell surface and functions as a biocatalyst. The enzyme displayed on the yeast cell surface catalyzes the hydrolysis of xylan into XOS. Additionally, the yeast cells themselves can serve as a source of yeast protein. Mfα1, α-mating factor signal peptide; Anchor, six anchor protein genes (AGA2, CWP1, CWP2, SED1, PIR1 and TIR1); TsaGH11, gene encoding GH11 family endo-xylanase from Thermoanaerobacterium saccharolyticum; XOS, xylo-oligosaccharides.
Download Original Figure

We constructed expression cassettes by fusing the endo-xylanase gene with the MFα1 signal peptide and six anchor proteins derived from S. boulardii. These cassettes were integrated into the intergenic region #1 of Chromosome VII in S. boulardii (Fig. 1A). As a result, six recombinant strains, designated X-Aga2, X-Cwp1, X-Cwp2, X-Sed1, X-Pir1, and X-Tir1, were constructed. Previous studies have demonstrated successful surface expression of eGFP in S. boulardii using the same approach [15].

Comparison of endo-xylanase expression efficiency and strain selection

The enzyme activity of the six recombinant strains, each immobilized with a different anchor protein, was measured to compare expression efficiency. Since the yeast cells functioned as whole-cell biocatalysts, the strains themselves were directly used for enzyme activity assays. Using beechwood xylan as the substrate, all six recombinant strains exhibited higher enzyme activity than the wild-type S. boulardii after a 30-min reaction, indicating successful surface immobilization of endo-xylanase. Among the strains, X-Tir1 exhibited the highest enzyme activity and was selected for subsequent fermentation experiments (Fig. 3).

jast-67-6-1379-g3
Fig. 3. Endo-xylanase activity in different strains depending on the anchor protein type. The enzyme activity of endo-xylanase anchored on the cell surface was measured using 0.5% beechwood xylan as the substrate in 50 mM sodium acetate buffer (pH 5.0) at 30°C and 130 rpm for 30 min, followed by DNS assay for sugar quantification. All experiments were performed in biological triplicates; error bars indicate standard deviations. Means with the same letter are not significantly different from each other (Tukey’s HSD test, p < 0.05).
Download Original Figure
Validation of strains through beechwood xylan fermentation

Prior to biomass fermentation, we confirmed that the selected X-Tir1 strain retained consistent enzyme activity during fermentation. Using 20 g/L of beechwood xylan as the substrate to test fermentation efficiency, the wild-type S. boulardii failed to degrade xylan. In contrast, the recombinant X-Tir1 strain produced approximately 4.3 g/L of XOS (X6–X2) after 72 h of fermentation (Fig. 4). When beechwood xylan was used as the substrate, peaks corresponding to lower degrees of polymerization (DP) XOS, such as X3 and X2, were primarily observed (Fig. 5A), which aligns with findings from previous studies [16]. This result confirms that the X-Tir1 strain maintained sufficient endo-xylanase activity under the mild conditions of 30°C and pH 6.5.

jast-67-6-1379-g4
Fig. 4. Xylo-oligosaccharides (XOS) production by wild-type and X-Tir1 during beechwood xylan fermentation. Wild-type, Saccharomyces boulardii wild-type strain; X-Tir1, a recombinant S. boulardii strain with endo-xylanase anchored by the Tir1 protein. Cultures were prepared in YP medium (10 g/L yeast extract and 20 g/L peptone) supplemented with 20 g/L glucose and 20 g/L xylan solution (YPDX) at 30°C and 130 rpm, with an initial OD of 1. All experiments were performed in biological triplicates, with error bars representing standard deviations.
Download Original Figure
jast-67-6-1379-g5
Fig. 5. Profile of xylan fermentation products. (A) Fermentation was performed using wild-type and X-Tir1 with beechwood xylan as the substrate. Wild-type, Saccharomyces boulardii wild-type strain; X-Tir1, a recombinant S. boulardii strain with endo-xylanase anchored by the Tir1 protein. (B) Fermentation was performed using X-Tir1 with corn cobs and beechwood xylan as substrates. Corn cobs, 2% NaOH-pretreated corn cobs. The reaction products were analyzed by HPLC, with X1–X6 representing different xylo-oligosaccharides with varying degrees of polymerization (DP). X1, xylose; X2, xylobiose; X3, xylotriose; X4, xylotetraose; X5, xylopentaose; X6, xylohexaose.
Download Original Figure
Xylo-oligosaccharides and yeast protein production from corn cobs

To efficiently utilize xylan from corn cobs, optimal pretreatment conditions were investigated. Among various biomass pretreatment methods, 1% H₂SO₄ pretreatment is one of the most widely used approaches [20]. In this study, solids treated with 1% H₂SO₄ produced approximately 3.4 g/L of XOS after 24 h of fermentation, likely attributed to the extensive hydrolysis of xylan into xylose. This observation is consistent with previous reports indicating that acid pretreatment primarily decomposes xylan into monosaccharides such as xylose [21]. The presence of approximately 9.4 g/L of xylose at the beginning of the fermentation process further supports this interpretation (Fig. 6B). Similarly, the heat-treated control group, which only received distilled water, exhibited low XOS production (Fig. 6A), likely due to insufficient breakdown of hydrogen and ester bonds between the components [22]. These results indicate that neither water nor acid pretreatment is suitable for efficient XOS production, highlighting the need for alkaline pretreatment.

jast-67-6-1379-g6
Fig. 6. Xylo-oligosaccharides (XOS) and yeast protein production from corn cobs through simultaneous saccharification and fermentation (SSF). Corn cob samples were pretreated by thermal processing under various chemical conditions, including (A) distilled water (control), (B) 1% H2SO4, (C) 2% NaOH, (D) 7% NaOH, and (E) 12% NaOH. Pre-treated samples were fermented with the X-Tir1 strain and 3% Cellic® CTec3 cellulase in YP medium (10% solid loading) at 30°C and 250 rpm. All experiments were performed in biological triplicates, with error bars representing standard deviations.
Download Original Figure

In contrast, alkaline pretreatment effectively breaks the hydrogen bonds between lignin-cellulose and hemicellulose-cellulose, as well as the ester bonds between lignin and hemicellulose, allowing for more efficient solubilization of xylan [23]. To identify the optimal alkaline pretreatment conditions, pretreatment was performed using 2%, 7%, and 12% (w/v) NaOH solutions and the results were analyzed. The solids pretreated with 2% (w/v) NaOH yielded the highest XOS production, approximately 15.2 g/L, after 72 h of fermentation (Fig. 6C). However, XOS production decreased with higher NaOH concentrations (Figs. 6C, 6D, and 6E), likely due to excessive solubilization of xylan into the liquid fraction during pretreatment, as well as increased salt formation during neutralization, which reduced the purity of xylan [23].

Furthermore, in contrast to fermentation using beechwood xylan as the substrate, fermentation with corn cobs produced XOS with varying DP, ranging from X2 to X6. This variation is likely attributed to structural differences in the xylan (Fig. 5B). Beechwood xylan has a simple glucuronoxylan structure, whereas corn cob xylan possesses a more complex glucuronoarabinoxylan structure with arabinose side chains [24,25].

Cell growth, which serves as an indicator of yeast protein production, was highest under the 2% NaOH pretreatment condition. In contrast, pretreatment with higher NaOH concentrations resulted in a significant decline in cell growth rates. This reduction is likely due to the inhibitory effects of salt formation during pretreatment [26]. Consequently, the 2% (w/v) NaOH pretreatment condition was determined to be optimal, yielding 15.2 g/L of XOS and 1.48 × 10⁹ cells/mL of yeast after 72 h of fermentation (Fig. 6).

Mass balance of the process for xylo-oligosaccharides and yeast protein production

The initial 100 g of raw corn cobs contained 33.6 g of cellulose, 30.5 g of hemicellulose, 7.2 g of lignin, and 28.7 g of other components. Following pretreatment with 2% (w/v) NaOH, 62.1 g of pretreated corn cob solids were obtained, consisting of 35.9 g of cellulose, 12 g of hemicellulose, 0.4 g of lignin, and 13.8 g of other components.

Alkaline pretreatment effectively reduced the lignin content, which, in turn, enhanced the accessibility of cellulose and hemicellulose for enzymatic hydrolysis. Following SSF, 9.4 g of XOS and 7.9 g of DCW were produced from 62.1 g of pretreated corn cob solids (Fig. 7).

jast-67-6-1379-g7
Fig. 7. Mass balance of the process for xylo-oligosaccharides (XOS) and yeast protein production from corn cobs. Corn cobs were pretreated with 2% (w/v) NaOH to reduce lignin content and improve digestibility. The pretreated biomass was subsequently subjected to simultaneous saccharification and fermentation (SSF) to produce XOS and yeast proteins, which were quantified as dry cell weight (DCW).
Download Original Figure

DISCUSSION

Over the past two decades, the market for XOS as a prebiotic has steadily expanded, prompting the development of various strategies to improve efficiency and maximize the yield of XOS production [27]. XOS can be produced from lignocellulosic biomass by using xylan, using production methods including chemical synthesis, enzymatic hydrolysis, or a combination of chemical and enzymatic treatments [12]. Among these, enzymatic hydrolysis offers several advantages over other methods, including control over the DP and the ability to produce functional XOS with high purity and low DP. Numerous studies have reported successful XOS production through enzymatic hydrolysis [2830]. However, the extraction of xylan and enzyme purification remain critical steps, adding complexity to the process.

This study proposes the use of a cell surface display system to immobilize enzymes, which addresses some of these challenges. Enzymes immobilized on the cell surface can be easily reused through simple cell recovery, eliminating the need for a separate enzyme purification process. Additionally, they retain activity under mild reaction conditions, thereby enhancing reaction efficiency [19]. Recent research on cell surface display systems has emphasized the crucial role of anchor proteins in optimizing display efficiency [31]. In this study, we compared various anchor proteins, including Aga2 (Agglutinin type), Cwp1, Cwp2, Sed1, Pir1, and Tir1 (GPI type), as well as Pir1 (PIR type) [19]. A previous study utilized six different anchor proteins to express eGFP protein, with Sed1 demonstrating the most effective protein immobilization on the cell surface [15]. However, in this study, Tir1 exhibited the highest enzyme expression efficiency, suggesting that the optimal choice of anchor protein may vary depending on the target protein. Therefore, selecting the optimal anchor protein that aligns with the characteristics of the expressed protein and the specific substrate requirements is crucial for maximizing enzyme activity [32].

Research on cell surface display systems using S. boulardii has been limited, and this study demonstrates the potential to expand the application of display technology by utilizing S. boulardii strains. Recognized as Generally Recognized as Safe (GRAS), S. boulardii can be safely used in animal feed. This study employed CRISPR/Cas9-based genome integration instead of plasmid insertion, eliminating the need for antibiotic resistance genes, thus resulting in a safer strain for feed applications [33,34]. The strain developed in this study offers an innovative strategy for simultaneously supplying XOS and yeast protein through enzyme immobilization on the yeast cell surface, offering a safe solution for animal feed.

Corn cob has the potential to serve as an alternative fiber-based feed ingredient for livestock. However, its low palatability and high lignin content result in reduced nutritional value, poor digestibility, and limited feed efficiency. To overcome these limitations and enhance its nutritional value, microbial fermentation has been proposed as an effective strategy [3537]. Previous studies have demonstrated that dietary supplementation with XOS significantly improves average daily gain (ADG), thereby enhancing growth performance and feed efficiency [38,39]. Additionally, yeast supplementation has been shown to improve feed efficiency, suppress intestinal inflammation, protect gut barrier function, and prevent E. coli infections, ultimately promoting gut health [40]. Although this study did not directly assess the functional effects of the fermented product as a feed additive, the findings from previous studies suggest that it may offer similar benefits. Future investigation through in vivo animal trials is warranted to validate its functionality and optimize its application.

The pretreatment process to enhance xylan accessibility was optimized. When 2%, 7%, and 12% (w/v) NaOH were applied to corn cob powder, high alkaline concentrations negatively impacted XOS production. Typically, high-concentration NaOH treatments solubilize glucan and xylan into the liquid fraction, reducing the amount of xylan remaining in the solid fraction and generating substantial amounts of salt (NaCl) during neutralization, which diminished the purity of xylan [23,41]. To address the issue of salt formation, NaOH removal steps, such as dialysis or membrane filtration, are required [23]. However, high-concentration alkaline pretreatment tends to reduce both solid recovery and XOS production, limiting its practical application. Therefore, for efficient utilization of xylan in the solid fraction, low-concentration alkaline pretreatment, such as 2% NaOH, is required [7]. In this study, 2% (w/v) NaOH pretreatment, which induced moderate delignification, was considered the optimal condition for enhancing xylan accessibility. Future studies should focus on utilizing the solubilized xylan from the pretreatment process to produce additional XOS or on valorizing lignin to generate high-value compounds such as furfural, vanillin, and syringaldehyde [7].

Fermentation of pretreated corn cobs produced XOS with varying DP from X2 to X6. The biological functions of XOS are closely linked to their DP, with beneficial gut bacteria such as Bifidobacterium and Lactobacillus typically favoring low DP X2 and X3 oligosaccharides [9,42]. Therefore, further studies are needed to explore the potential of enhancing the utilization of low-DP oligosaccharides by improving enzymatic hydrolysis efficiency, particularly through the addition of GH10 family endo-xylanase [24,30].

In this study, SSF was employed to simultaneously produce XOS and yeast protein from corn cobs. SSF integrates enzymatic hydrolysis and fermentation into a single process, simplifying the overall procedure. However, a general limitation exists, as the optimal temperature and pH for enzymatic hydrolysis and fermentation differ [43]. In this study, this limitation was addressed by immobilizing enzymes on the yeast cell surface, thereby simplifying the SSF process. In previous methods, XOS production was followed by treating residual solids with cellulase to convert them into fermentable monosaccharides, subsequently producing yeast protein [13,44,45]. In contrast, this study integrated these steps into a single SSF process, demonstrating the feasibility of simultaneously producing both XOS and yeast protein. While further optimization and scale-up studies are required, this approach offers a promising strategy for utilizing agricultural residues to develop functional feed additives in a more cost-effective and environmentally sustainable manner.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This research was supported by the Bio&Medical Technology Development Program of the National Research Foundation (NRF) funded by the Korean government (MSIT) (No. RS-2024-00439872). This research was also supported by the Bio&Medical Technology Development Program of the National Research Foundation (NRF) funded by the Korean government (MSIT) (No. RS-2024-00452695). This work was also supported by the National Research Foundation of Korea (NRF) grant funded by the Korean government (MSIT) (No. 2022R1A2C1093074). This work was also supported by the Technology Innovation Program (or Industrial Strategic Technology Development Program-Industrial Technology Alchemist project)(20025698) funded by the Ministry of Trade, Industry & Energy (MOTIE, Korea). Lastly, this study is supported by Cooperative Research Program for Agriculture Science and Technology Development (Project No. RS-2025-02263976) in Rural Development Administration, Korea.

Acknowledgements

Not applicable.

Availability of data and material

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Authors’ contributions

Conceptualization: Kim IJ, Kim SR.

Data curation: Lee G.

Formal analysis: Lee G .

Methodology: Kim IJ, Kim SR.

Software: Lee G.

Validation: Lee G, Kim IJ, Kim SR.

Investigation: Lee G, Kim IJ, Kim SR.

Writing - original draft: Lee G.

Writing - review & editing: Lee G, Kim IJ, Kim SR.

Ethics approval and consent to participate

This article does not require IRB/IACUC approval because there are no human and animal participants.

REFERENCES

1.

Pandey AK, Kumar P, Saxena MJ. Feed additives in animal health.In In: Gupta RC, Srivastava A, Lall R, editors.editors Nutraceuticals in veterinary medicine. Springer. 2019; p p. 345-62

2.

Callaway TR, Carr MA, Edrington TS, Anderson RC, Nisbet DJ. Diet, Escherichia coli O157:H7, and cattle: a review after 10 years. Curr Issues Mol Biol. 2009; 11:67-80.

3.

Wiggins S, Keats S. Grain stocks and price spikes. Overseas Development Institute (ODI). 2010.

4.

Baker A, Lutman H. Feed year in review (domestic): feed grain prices remained strong. 2010Economic Research Service, USDA. 2010Report No.: FDS-2010-01.

5.

Lohlum SA, Forcados EG, Chuku A, Agida OG, Ozele N. Corn cob as a feed component through fungal fermentation using Aspergillus niger. CIBTech J Microbiol. 2014; 3:37-42.

6.

Carvalho AFA, de Oliva Neto P, da Silva DF, Pastore GM. Xylo-oligosaccharides from lignocellulosic materials: chemical structure, health benefits and production by chemical and enzymatic hydrolysis. Food Res Int. 2013; 51:75-85

7.

Boonchuay P, Techapun C, Leksawasdi N, Seesuriyachan P, Hanmoungjai P, Watanabe M, et al. An integrated process for xylooligosaccharide and bioethanol production from corncob. Bioresour Technol. 2018; 256:399-407

8.

Jach ME, Serefko A, Ziaja M, Kieliszek M. Yeast protein as an easily accessible food source. Metabolites. 2022; 12:63

9.

Kukreti N, Kag S, Ruhal R, Kataria R. A sustainable biorefinery approach to valorize corn waste to valuable chemicals.In In: Nandabalan YK, Garg VK, Labhsetwar NK, Singh A, editors.editors Zero waste biorefinery. Springer. 2022; p p. 269-92

10.

Seesuriyachan P, Kawee-ai A, Chaiyaso T. Green and chemical-free process of enzymatic xylooligosaccharide production from corncob: enhancement of the yields using a strategy of lignocellulosic destructuration by ultra-high pressure pretreatment. Bioresour Technol. 2017; 241:537-44

11.

Lin B, Yan J, Zhong Z, Zheng X. A study on the preparation of microbial and nonstarch polysaccharide enzyme synergistic fermented maize cob feed and its feeding efficiency in finishing pigs. BioMed Res Int. 2020; 2020:8839148

12.

Palaniappan A, Antony U, Emmambux MN. Current status of xylooligosaccharides: production, characterization, health benefits and food application. Trends Food Sci Technol. 2021; 111:506-19

13.

Chen M, Li Q, Zhang Y, Li H, Lu J, Cheng Y, et al. Xylo-oligosaccharides enriched yeast protein feed production from reed sawdust. Bioresour Technol. 2018; 270:738-41

14.

Gietz RD, Schiestl RH. High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat Protoc. 2007; 2:31-4

15.

Shin J, Lee G, Chi WJ, Park S, Jin YS, Kim SR. Engineering Saccharomyces boulardii for cell surface display of heterologous protein. J Biotechnol. 2025; 397:44-50

16.

Kim IJ, Kim SR, Kim KH, Bornscheuer UT, Nam KH. Characterization and structural analysis of the endo-1,4-β-xylanase GH11 from the hemicellulose-degrading Thermoanaerobacterium saccharolyticum useful for lignocellulose saccharification. Sci Rep. 2023; 13:17332

17.

Aza P, Molpeceres G, de Salas F, Camarero S. Design of an improved universal signal peptide based on the α-factor mating secretion signal for enzyme production in yeast. Cell Mol Life Sci. 2021; 78:3691-707

18.

Loll-Krippleber R, Sajtovich VA, Ferguson MW, Ho B, Burns AR, Payliss BJ, et al. Development of a yeast whole-cell biocatalyst for MHET conversion into terephthalic acid and ethylene glycol. Microb Cell Fact. 2022; 21:280

19.

Lozančić M, Hossain AS, Mrša V, Teparić R. Surface display: an alternative to classic enzyme immobilization. Catalysts. 2019; 9:728

20.

Kuglarz M, Alvarado-Morales M, Dąbkowska K, Angelidaki I. Integrated production of cellulosic bioethanol and succinic acid from rapeseed straw after dilute-acid pretreatment. Bioresour Technol. 2018; 265:191-9

21.

Jin C, Bao J. Lysine production by dry biorefining of wheat straw and cofermentation of Corynebacterium glutamicum. J Agric Food Chem. 2021; 69:1900-6

22.

Arumugam A, Malolan VV, Ponnusami V. Contemporary pretreatment strategies for bioethanol production from corncobs: a comprehensive review. Waste Biomass Valorization. 2021; 12:577-612

23.

Lehuedé L, Henríquez C, Carú C, Córdova A, Mendonça RT, Salazar O. Xylan extraction from hardwoods by alkaline pretreatment for xylooligosaccharide production: a detailed fractionation analysis. Carbohydr Polym. 2023; 302:120381

24.

Capetti CCM, Vacilotto MM, Dabul ANG, Sepulchro AGV, Pellegrini VOA, Polikarpov I. Recent advances in the enzymatic production and applications of xylooligosaccharides. World J Microbiol Biotechnol. 2021; 37:1-12

25.

Curry TM, Peña MJ, Urbanowicz BR. An update on xylan structure, biosynthesis, and potential commercial applications. Cell Surf. 2023; 9:100101

26.

Logothetis S, Nerantzis ET, Gioulioti A, Kanelis T, Panagiotis T, Walker G. Influence of sodium chloride on wine yeast fermentation performance. Int J Wine Res. 2010; 2010:35-42

27.

Valladares-Diestra KK, Vandenberghe LPS, Vieira S, Goyzueta-Mamani LD, de Mattos PBG, Manzoki MC, et al. The potential of xylooligosaccharides as prebiotics and their sustainable production from agro-industrial by-products. Foods. 2023; 12:2681

28.

Samanta AK, Jayapal N, Kolte AP, Senani S, Sridhar M, Suresh KP, et al. Enzymatic production of xylooligosaccharides from alkali solubilized xylan of natural grass (Sehima nervosum). Bioresour Technol. 2012; 112:199-205

29.

Ghosh D, Vir AB, Garnier G, Patti AF, Tanner J. Continuous flow production of xylooligosaccharides by enzymatic hydrolysis. Chem Eng Sci. 2021; 244:116789

30.

Capetti CCM, Pellegrini VOA, Santo MCE, Cortez AA, Falvo M, Curvelo AAS, et al. Enzymatic production of xylooligosaccharides from corn cobs: assessment of two different pretreatment strategies. Carbohydr Polym. 2023; 299:120174

31.

Zhang C, Chen H, Zhu Y, Zhang Y, Li X, Wang F. Saccharomyces cerevisiae cell surface display technology: strategies for improvement and applications. Front Bioeng Biotechnol. 2022; 10:1056804

32.

Inokuma K, Kurono H, den Haan R, van Zyl WH, Hasunuma T, Kondo A. Novel strategy for anchorage position control of GPI-attached proteins in the yeast cell wall using different GPI-anchoring domains. Metab Eng. 2020; 57:110-7

33.

Liu JJ, Kong II, Zhang GC, Jayakody LN, Kim H, Xia PF, et al. Metabolic engineering of probiotic Saccharomyces boulardii. Appl Environ Microbiol. 2016; 82:2280-7

34.

Wang Y, Wang S, Chen W, Song L, Zhang Y, Shen Z, et al. CRISPR-Cas9 and CRISPR-assisted cytidine deaminase enable precise and efficient genome editing in Klebsiella pneumoniae. Appl Environ Microbiol. 2018; 84:e01834-18

35.

Dewi YL, Ismail A, Akramullah M, Bouk G, Kamlasi Y, Sinabang MK, et al. Effect of corn waste fermentation as livestock feed on fiber fraction content. Int J Environ Agric Biotechnol. 2022; 7:108-12

36.

Khonyoung D, Sittiya J, Yamauchi K. Growth performance, carcass quality, visceral organs and intestinal histology in broilers fed dietary dried fermented ginger and/or fermented corncob powder. Food Nutr Sci. 2017; 8:565-77

37.

Fan W, Huang X, Liu K, Xu Y, Chi Z. Symbiosis of Aspergillus niger and Candida utilis for improving nutrition and digestibility in co-fermentation of corn-ethanol co-product and corncob. Biomass Convers Biorefin. 2024; 14:11963-75

38.

Li X, Wu X, Ma W, Xu H, Chen W, Zhao F. Feeding behavior, growth performance and meat quality profile in broiler chickens fed multiple levels of xylooligosaccharides. Animals. 2023; 13:2582

39.

Liu JB, Cao SC, Liu J, Xie YN, Zhang HF. Effect of probiotics and xylo-oligosaccharide supplementation on nutrient digestibility, intestinal health and noxious gas emission in weanling pigs. Asian-Australas J Anim Sci. 2018; 31:1660-9

40.

Wang W, Li Z, Han Q, Guo Y, Zhang B, D’inca R. Dietary live yeast and mannan-oligosaccharide supplementation attenuate intestinal inflammation and barrier dysfunction induced by Escherichia coli in broilers. Br J Nutr. 2016; 116:1878-88

41.

Tan J, Li Y, Tan X, Wu H, Li H, Yang S. Advances in pretreatment of straw biomass for sugar production. Front Chem. 2021; 9:696030

42.

Moura P, Barata R, Carvalheiro F, Gírio F, Loureiro-Dias MC, Esteves MP. In vitro fermentation of xylo-oligosaccharides from corn cobs autohydrolysis by Bifidobacterium and Lactobacillus strains. LWT Food Sci Technol. 2007; 40:963-72

43.

Olofsson K, Bertilsson M, Lidén G. A short review on SSF – an interesting process option for ethanol production from lignocellulosic feedstocks. Biotechnol Biofuels. 2008; 1:1-14

44.

Gu Y, Hu Y, Huang C, Lai C, Ling Z, Yong Q. Co-production of amino acid-rich xylooligosaccharide and single-cell protein from paper mulberry by autohydrolysis and fermentation technologies. Biotechnol Biofuels Bioprod. 2022; 15:1

45.

Zhao S, Wang ZB, Wang YC, Yang PY, Luo XM, Wu AM, et al. Sustainable coproduction of xylooligosaccharide, single-cell protein and lignin-adsorbent through whole components’ utilization of sugarcane bagasse with high solid loading. Sep Purif Technol. 2023; 308:122916

46.

Kim SR, Xu H, Lesmana A, Kuzmanovic U, Au M, Florencia C, et al. Deletion of PHO13, encoding haloacid dehalogenase type IIA phosphatase, results in upregulation of the pentose phosphate pathway in Saccharomyces cerevisiae. Appl Environ Microbiol. 2015; 81:1601-9

47.

Park S, Park BR, Jeong D, Park J, Ko JK, Kim SJ, et al. Functional expression of RuBisCO reduces CO2 emission during fermentation by engineered Saccharomyces cerevisiae. Process Biochem. 2023; 134:286-93

PDF Download
PubReader
Export Citation
Email the Author

Metrics

View
5,686
Download
1,468
Crossref
3
Scopus
3

QR Code of this Article:




Revised Publication Charge


(Effective for articles submitted beginning January 1, 2026)

The publication charge is 1,500,000 Korean Won per article for members of the Korean Society of Animal Science and Technology (KSAST), and 2,000,000 Korean Won for non-members. First and corresponding authors are required to pay the annual membership fee.

The publication charge for a corresponding author outside Korea is 1,500 US dollars per article.


I don't want to open this window for a day.