RESEARCH ARTICLE

Intestinal segment and vitamin D3 concentration affect gene expression levels of calcium and phosphorus transporters in broiler chickens

Jincheng Han1,2,*https://orcid.org/0000-0003-0461-2103, Lihua Wu1,2,3https://orcid.org/0000-0003-4408-3330, Xianliang Lv1,2,3https://orcid.org/0000-0003-4679-8188, Mengyuan Liu1,2,3https://orcid.org/0000-0001-7487-2897, Yan Zhang1,2,3https://orcid.org/0000-0003-3436-6740, Lei He1,2,4https://orcid.org/0000-0001-5313-7607, Junfang Hao1,2https://orcid.org/0000-0002-2038-5839, Li Xi1,2,*https://orcid.org/0000-0003-3639-1907, Hongxia Qu1,2https://orcid.org/0000-0003-2964-7898, Chuanxin Shi1,2https://orcid.org/0000-0002-1750-0103, Zhiqiang Li1,2https://orcid.org/0000-0002-1719-3502, Zhixiang Wang3https://orcid.org/0000-0002-0176-7604, Fei Tang5https://orcid.org/0000-0002-6200-9356, Yingying Qiao6https://orcid.org/0000-0002-0090-6430
Author Information & Copyright ▼
1Department of Animal Science, College of Biology and Food, Shangqiu Normal University, Shangqiu 476000, China
2Henan Engineering Research Center of Green Feed Additive Development and Application, Shangqiu 476000, China
3College of Animal Science and Technology, Henan Agricultural University, Zhengzhou 450001, China
4College of Life Sciences, Henan Normal University, Xinxiang 453007, China
5Shandong Haineng Bioengineering Co., Ltd., Rizhao 276800, China
6Department of Biochemistry and Biotechnology, Sumy National Agrarian University, Sumy 40000, Ukraine
*Corresponding author: Jincheng Han, Department of Animal Science, College of Biology and Food, Shangqiu Normal University, Shangqiu 476000, China. Tel: +86-370-2582849, E-mail: j.c.han@hotmail.com
*Corresponding author: Li Xi, Department of Animal Science, College of Biology and Food, Shangqiu Normal University, Shangqiu 476000, China. Tel: +86-370-2582849, E-mail: xili_0808@163.com

© Copyright 2023 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Aug 09, 2022; Revised: Sep 06, 2022; Accepted: Sep 16, 2022

Published Online: Mar 31, 2023

Abstract

Two experiments were conducted in this research. Experiment 1 investigated the spatial expression characteristics of calcium (Ca) and phosphorus (P) transporters in the duodenum, jejunum, and ileum of 21-day-old broilers provided with adequate nutrient feed. Experiment 2 evaluated the effects of dietary vitamin D3 (VD3) concentration (0, 125, 250, 500, 1,000, and 2,000 IU/kg) on growth performance, bone development, and gene expression levels of intestinal Ca and P transporters in 1–21-day-old broilers provided with the negative control diet without supplemental VD3. Results in experiment 1 showed that the mRNA levels of calcium-binding protein 28-kDa (CaBP-D28k), sodium-calcium exchanger 1 (NCX1), plasma membrane calcium ATPase 1b (PMCA1b), and IIb sodium-phosphate cotransporter (NaPi-IIb) were the highest in the broiler duodenum. By contrast, the mRNA levels of inorganic phosphate transporter 1 (PiT-1) and 2 (PiT-2) were the highest in the ileum. Results in experiment 2 showed that adding 125 IU/kg VD3 increased body weight gain (BWG), feed intake (FI), bone weight, and percentage and weight of Ca and P in the tibia and femur of 1–21-day-old broilers compared with the negative control diet (p < 0.05). The rise in dietary VD3 levels from 125 to 1,000 IU/kg further increased the BWG, FI, and weights of the bone, ash, Ca, and P (p < 0.05). No difference in growth rate and leg bone quality was noted in the broilers provided with 1,000 and 2,000 IU/kg VD3 (p > 0.05). Supplementation with 125–2,000 IU/kg VD3 increased the mRNA abundances of intestinal Ca and P transporters to varying degrees. The mRNA level of CaBP-D28k increased by 536, 1,161, and 28 folds in the duodenum, jejunum, and ileum, respectively, after adding 1,000 IU/kg VD3. The mRNA levels of other Ca and P transporters (PMCA1b, NCX1, NaPi-IIb, PiT-1, and PiT-2) increased by 0.57–1.74 folds by adding 1,000–2,000 IU/kg VD3. These data suggest that intestinal Ca and P transporters are mainly expressed in the duodenum of broilers. Moreover, the addition of VD3 stimulates the two mineral transporter transcription in broiler intestines.

Keywords: Vitamin D3; Broiler chicken; CaBP-D28k; PMCA1b; NaPi-IIb; PiT-1

INTRODUCTION

Vitamin D3 (cholecalciferol, VD3) is a nutrient for animal growth, health, and bone development. Its deficiency damages bone quality, while the addition of VD3 improves growth performance and blood calcium (Ca) and phosphorus (P) homeostasis in broiler chickens [1]. The VD3 requirement of 1–21-day-old broiler chickens estimated by NRC is 200 IU/kg [2]. The recommended dietary VD3 level for broilers in China is 1,000 IU/kg [3]. Research has shown that 1,000–2,000 IU/kg VD3 is needed to support the growth performance and leg bone mineralization of broilers [4]. Thus, the requirement of modern broilers for VD3 may be higher than that recommended by NRC [2]. The primary function of VD3 is to regulate the absorption of Ca and P in animal intestines. Ca and P are the two mineral elements that are added most in feed and needed most in animal body. Research in mammals has shown that the response of intestinal Ca and P absorption of rats to vitamin D correlates with the gene expression of Ca and P transporters [5,6].

Calcium is absorbed through active transcellular transport and passive transport in animal enterocytes [7]. The transcellular transport of Ca involves three procedures: Ca enters intestinal cells, moves to the basolateral membrane, and extrudes into the blood [7]. The first procedure is intestinal Ca transport, which relies on transient receptor potential channels (TRPV6 and TRPV5) [7]. The second procedure is the movement of Ca in the cytoplasm, which depends on two Ca-binding proteins (i.e., CaBP-D28k and CaBP-D9k) [8]. The final procedure is the extrusion of Ca, which is performed through sodium-calcium exchanger 1 (NCX1) and plasma membrane calcium ATPase 1b (PMCA1b) [8]. CaBP-D28k and CaBP-D9k exist in the intestines of poultry and mammals, respectively. Intestinal TRPV6, CaBP-D28k, and PMCA1b have been cloned in laying hens [9,10]. There is no report of TRPV6 in broilers [11].

Phosphate transport from the brush border membrane of intestinal enterocytes into the cytoplasm is an active absorption process. Three P transporters, namely, IIb sodium-phosphate cotransporter (NaPi-IIb), inorganic P transporter 1 (PiT-1), and inorganic P transporter 2 (PiT-2), are involved in active P absorption in animal intestines [8]. The mRNA abundances of NaPi-IIb, PiT-1, and PiT-2 have been detected in the apical membrane of rat intestinal cells [12,13]. NaPi-IIb undertakes the majority of P absorption in mouse intestines, whereas, PiT-1 and PiT-2 assume a minor function in total P uptake [14]. These three P transporters have been cloned in broiler intestines [15].

The active absorption of Ca and P in the intestines of broilers relies on the existence of Ca and P transporters. The capacity of P absorption and gene expression abundance of NaPi-IIb in the duodenum are higher than those in the jejunum and ileum of broiler chicks [16]. The difference in protein abundance of duodenal, jejunal, and ileal CaBP-D28k has been noted in laying hens [17]. By contrast, the spatial expression characteristics of CaBP-D28k, PMCA1b, NCX1, PiT-1, and PiT-2 in the three intestinal segments of broilers have not been reported.

The injection of 1,25-dihydroxycholecalciferol (1,25-(OH)2-D3) increases blood Ca and P concentrations and improves Ca and P absorption by upregulating the protein expression of CaBP-D9k and the mRNA abundance of NaPi-IIb in rat intestines [6,18]. Meanwhile, the relationship between dietary VD3 dosage and the expression of Ca and P transporter genes in broiler intestines has not been clarified.

Thus, two experiments were conducted in this research. First, the differences in gene expression levels of Ca and P transporters in the duodenum, jejunum, and ileum were explored. Second, the response of the mRNA abundances of intestinal Ca and P transporters to dietary VD3 concentrations in broiler chickens was examined.

MATERIALS AND METHODS

The animal experiment procedures in this research were implemented in accordance with the guidelines of the Animal Ethics Committee of Shangqiu Normal University (2020-1012).

Animals, diets, and management
Experiment 1

Experiment 1 investigated the spatial expression characteristics of Ca and P transporters in the duodenum, jejunum, and ileum of 21-day-old broilers. One-day-old Arbor Acres broiler chickens (70, male) were grouped into five repetitions of 14 broilers per repetition. Broilers were provided with an adequate nutrient diet (Table 1) [3]. On day 21, total 10 broilers (2 chicks per repetition) were randomly selected and euthanized by cervical dislocation. The duodenum (after the gizzard), jejunum (proximal to Meckel’s diverticulum), and ileum (proximal to the ileocecal junction) were isolated. Intestinal mucosal samples from the three segments were scraped with a glass slide, collected in a centrifuge tube, immediately put into liquid nitrogen, and stored in −80°C refrigerator.

Table 1. Ingredient composition of the experimental diet (as fed basis)
Item Experiment 1 Experiment 2
Ingredient (g/kg)
 Corn 562.0 574.1
 Soybean meal (430 g/kg CP) 332.0 320.0
 Soybean oil 28.2 24.7
 Soy protein powder (650 g/kg CP) 36.8 41.2
 Limestone 13.5 12.2
 Dicalcium phosphate 19.4 19.3
 L-Lysine·HCl (980 g/kg) 1.4 1.8
 DL-Methionine (990 g/kg) 1.4 1.4
 Trace mineral premix1) 0.1 0.1
 Vitamin premix2),3) 0.2 0.2
 Choline chloride (500 g/kg) 2.0 2.0
 Sodium chloride 3.0 3.0
Nutrient composition
 Metabolizable energy (kcal/kg) 2,975.4 2,973.0
 Crude protein (g/kg) 215.1 212.3
 Analyzed calcium (g/kg) 10.0 10.1
 Analyzed total phosphorus (g/kg) 6.9 7.0
 Non-phytate phosphorus (g/kg) 4.5 4.5
 Lysine (g/kg) 11.2 11.1
 Methionine (g/kg) 5.0 5.1

1) Trace mineral premix supplied per kg of diet: Fe (FeSO4∙7H2O), 80 mg; Mn (MnSO4∙H2O), 60 mg; Zn (ZnSO4∙7H2O), 40 mg; Cu (CuSO4∙5H2O), 6 mg; I (KI), 0.35 mg; and Se (Na2SeO3), 0.15 mg.

2) Experiment 1, vitamin premix supplied per kg of diet: vitamin A (retinyl palmitate), 4.4 mg; vitamin D3, 25 µg (1,000 IU); vitamin E (DL-α-tocopheryl acetate), 20 mg; vitamin K3 (menadione), 0.5 mg; vitamin B1 (thiamine), 2 mg; vitamin B2 (riboflavin), 8 mg; vitamin B6 (pyridoxine), 3.5 mg; vitamin B12, 0.01 mg; biotin, 0.18 mg; folic acid, 0.55 mg; pantothenic acid, 10 mg; niacin, 35 mg.

3) Experiment 2, vitamin premix (without supplemental VD3) supplied per kg of diet: vitamin A (retinyl palmitate), 4.4 mg; vitamin E (DL-α-tocopheryl acetate), 20 mg; vitamin K3 (menadione), 0.5 mg; vitamin B1 (thiamine), 2 mg; vitamin B2 (riboflavin), 8 mg; vitamin B6 (pyridoxine), 3.5 mg; vitamin B12, 0.01 mg; biotin, 0.18 mg; folic acid, 0.55 mg; pantothenic acid, 10 mg; niacin, 35 mg.

Download Excel Table
Experiment 2

Experiment 2 evaluated the effects of dietary vitamin D3 concentration on growth performance, bone development, and gene expression levels of intestinal Ca and P transporters in 1–21-day-old broilers. One-day-old Arbor Acres broiler chickens (420, male) were randomly grouped into six treatments. Each treatment contained five repetitions with 14 broilers per repetition. Dietary VD3 levels were 0, 125, 250, 500, 1,000, and 2,000 IU/kg. The negative control diet contained 10.0 g/kg Ca and 4.5 g/kg non-phytate P and did not contain supplemental VD3 (Table 1) [2].

The VD3 crystal was supplied by Tianhecheng Biological Technology (Jiaxing, Zhejiang, China). The VD3 solution was prepared in accordance with previous research [19]. After weighing, the crystalline VD3 was dissolved in ethanol. Propylene glycol was used to dilute the VD3 solution. The concentration of the VD3 solution was 45.3 µg/mL (1,812 IU/mL) as measured by high-performance liquid chromatography. The VD3 solution was supplemented in broiler chicken feed with a pipette.

The broilers were housed in pens (width 140 cm, depth 70 cm, and height 35 cm). The broilers were fed with mash feed ad libitum and provided with 23 h of lighting on days 1–3 and 18 h of lighting on days 4–21. The temperature of the room was kept at 32°C on days 1–3, 30°C on days 4–7, and 28°C on days 8–21.

Sample collection

The broilers were weighed by pen at 1 and 21 days of age. The feed intake (FI) per day of the broilers was weighed. The total FI was calculated from 1 to 21 days of age. Body weight gain (BWG) was the difference between the body weight (BW) of the broilers at 21 and 1 day of age. Feed conversion ratio (FCR) was the ratio of the FI to the BWG. The dead broilers during the experiment were weighed and recorded. On day 21, 10 broilers per treatment (2 broilers per repetition) were chosen and euthanized by cervical dislocation. The small intestine was exposed after the broilers were euthanized. Intestinal mucosal samples from the duodenum (after the gizzard), jejunum (proximal to Meckel’s diverticulum), and ileum (proximal to the ileocecal junction) were scraped with a glass slide and collected in a centrifuge tube. Then, the mucosal samples were immediately put into liquid nitrogen and stored in −80°C refrigerator.

The two leg bones (tibia and femur) were removed, stored, and pre-treated [20]. Bone weight and length were measured after the bone was dried at 105°C for 24 h. The ash weights of the tibia and femur were measured after the samples were ashing in a muffle furnace (Selecta, Barcelona, Spain) at 650°C for 48 h. Bone ash, Ca, and P percentages are the ratios of their weight to the bone weight. The Ca contents in the diet and leg bones were analyzed by the AOAC method [21]. Total P contents were measured using the photometric method [22].

RNA extraction and real-time polymerase chain reaction

Total RNA extraction from the intestinal mucosal samples was implemented by RNAiso Plus Kit on the basis of the recommendation of the manufacturer (Takara Biotechnology, Dalian, Liaoning, China). RNA concentration was analyzed by spectrophotometry.

The cDNA was reverse-transcribed from RNA using PrimeScriptTM RT Reagent Kit based on the instructions of the manufacturer (Takara Biotechnology).

Real-time PCR analysis was conducted for the Ca and P transporter gene expression (i.e., CaBP-D28k, PMCA1b, NCX1, NaPi-IIb, PiT-1, and PiT-2). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the reference gene. PCR primers (Table 2) were synthesized in Shanghai Sangon Biotech(Shanghai, China). Gene expression was performed using the TB GreenTM Premix EX TaqTM II Kit (Takara Biotechnology) and the Roche Lightcycler® 480 Real-time PCR System (Basel, Switzerland). The PCR products were verified by melting curve analysis based on the following conditions: 95°C for 60 s, 40 cycles of 95°C for 10 s, 60°C for 30 s, and 72°C for 30 s. The mRNA abundances of the target genes relative to that of the GAPDH gene were calculated by the 2−ΔΔCt method [23]. The average ΔCt value from the negative control diet was used as the calibrator of each gene.

Table 2. Primer sequences in real-time quantitative PCR
Gene Accession number Orientation Primer sequence (5′-3′) Size (bp)
CaBP-D28k NM_205513.1 Forward AGATCTGGCACCACTACGAC 187
Reverse TGAGCAAGCTCAACGATTCCT
PMCAlb NM_001168002.3 Forward AGCTCAAGATGGTGCAGCTA 165
Reverse AACAAACCTGCTTTGCCAATCT
NCX1 NM_001079473.1 Forward TCACCTTCTTCTTCTTCCCAATCT 158
Reverse GCAACCTTTCCGTCCATCTC
NaPi-IIb NM_204474.1 Forward TCGGTCCGTTCACTCTGTTG 164
Reverse GCCACGTTGCCTTTGTGATT
PiT-1 XM_015297502.1 Forward GGCTCCGTGCTTCTGG 239
Reverse CATTTGACGCCTTTCTGC
PiT-2 NM_001305398.1 Forward GCAGCAGATACATCAACTC 153
Reverse ATTTCCACTCCACCCTC
GAPDH NM_204305.1 Forward GAACATCATCCCAGCGTCCA 133
Reverse ACGGCAGGTCAGGTCAACAA

PCR, polymerase chain reaction; bp, base pair; CaBP-D28k, calcium-binding protein 28-kDa; PMCA1b, plasma membrane calcium ATPase 1b; NCX1, sodium-calcium exchanger 1; NaPi-IIb, IIb sodium-dependent phosphate cotransporter; PiT-1, inorganic phosphate transporter 1; PiT-2, inorganic phosphate transporter 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Download Excel Table
Statistical analysis

Repetition pens were used as experimental units. Data analysis was conducted by one-way ANOVA in SAS 9.0 software [24]. Orthogonal polynomials contrast analysis was used to evaluate the linear and quadratic effects of dietary VD3 concentration on growth performance, bone development, and gene expression levels of intestinal Ca and P transporters. Figures were produced with GraphPad Prism software. Means were compared by Tukey’s test. The significance level was set at p < 0.05.

RESULTS

Experiment 1

The highest mRNA abundances of the three Ca transporters (CaBP-D28k, PMCA1b, and NCX1) were expressed in the broiler duodenum (Figs. 1A, 1B, and 1C). For P transporters, the mRNA abundance of NaPi-IIb in the duodenum was higher than those in the two other intestinal segments (p < 0.05, Fig. 1D). By contrast, the mRNA abundances of PiT-1 and PiT-2 were the lowest in the duodenum and highest in the ileum (Figs. 1E and 1F).

jast-65-2-336-g1
Fig. 1. mRNA abundances of calcium and phosphorus transporters in the three intestinal segments (duodenum, jejunum, and ileum) of 21-day-old broilers (experiment 1). (A) CaBP-D28k, calcium-binding protein 28-kDa; (B) PMCA1b, plasma membrane calcium ATPase 1b; (C) NCX1, sodium-calcium exchanger 1; (D) NaPi-IIb, IIb sodium-dependent phosphate cotransporter; (E) PiT-1, inorganic phosphate transporter 1; (F) PiT-2, inorganic phosphate transporter 2. The values are the means of five repetitions (n = 5) and presented as mean ± SD. a–cValues with different superscripts are significantly different (p < 0.05).
Download Original Figure
Experiment 2
Growth performance

The addition of VD3 increased the growth rate of 1–21-day-old broilers (Table 3). The broilers provided with 125 IU/kg VD3 had higher BW, BWG, and FI, and lower FCR than those supplied with the negative control diet (p < 0.05). Increasing the VD3 level from 125 to 1,000 IU/kg enhanced the BWG and FI (p < 0.05). No difference was detected in the BWG, FI, and FCR of the broilers provided with 1,000 and 2,000 IU/kg VD3 (p > 0.05). Dietary VD3 levels did not affect the mortality of broilers (p > 0.05).

Table 3. Effects of dietary vitamin D3 concentration on growth performance of 1–21-day-old broilers (experiment 2)1)
Vitamin D3 (IU/kg) Body weight on day 1 (g/chick) Body weight on day 21 (g/chick) Body weight gain (g/chick) Feed intake (g/chick) Feed conversion ratio (g/g) Mortality (%)
0 42.3 452c 410c 678c 1.66a 1.43
125 42.6 756b 713b 974b 1.37b 1.43
250 42.6 805ab 762ab 1,037ab 1.36b 4.29
500 42.3 815ab 773ab 1,020ab 1.32b 0
1,000 42.8 866a 823a 1,070a 1.30b 0
2,000 42.6 858a 815a 1,034ab 1.27b 2.86
SEM 0.16 27 27 25 0.03 0.66
p-value
 Linear 0.56 < 0.05 < 0.05 < 0.05 < 0.05 0.92
 Quadratic 0.86 < 0.05 < 0.05 < 0.05 < 0.05 0.85

1) Each value represents the mean of five repetitions (14 broilers per repetition) (n = 5). The negative control feed consisted of 10.0 g/kg calcium and 4.5 g/kg non-phytate phosphorus and did not contain supplemental VD3.

a–c Values with different superscripts are significantly different (p < 0.05).

Download Excel Table
Bone development

Dietary VD3 improved leg bone (tibia and femur) quality in 1–21-day-old broilers (Tables 4 and 5). The addition of 125 IU/kg VD3 increased the weight, length, and percentage and weight of Ca and P in the two leg bones (p < 0.05). The rise in dietary VD3 levels from 125 to 1,000 IU/kg increased the weights of the ash, Ca, and P (p < 0.05), but it did not influence their contents (p > 0.05). No difference in the weight, length, and percentage and weight of ash, Ca, and P of the tibia and femur was noted in the broilers provided with 1,000 and 2,000 IU/kg VD3 (p > 0.05).

Table 4. Effects of dietary vitamin D3 concentration on tibia development in 21-day-old broilers (experiment 2)1)
Vitamin D3 (IU/kg) Bone weight (g/bone) Bone length (cm/bone) Mineral percentage (%) Mineral weight (g/bone)
Ash Ca P Ash Ca P
0 0.99d 5.15c 38.3b 13.0b 6.92b 0.37d 0.13d 0.07c
125 1.41c 5.98b 48.3a 17.8a 8.92a 0.67c 0.25c 0.13b
250 1.63bc 6.1ab 49.5a 18.4a 9.56a 0.80b 0.30b 0.16a
500 1.73ab 6.15ab 49.5a 17.8a 9.50a 0.85ab 0.31b 0.16a
1,000 1.89a 6.35a 49.3a 18.1a 9.37a 0.93a 0.34a 0.18a
2,000 1.89a 6.30ab 48.9a 17.9a 9.19a 0.92a 0.34a 0.17a
SEM 0.06 0.08 0.8 0.4 0.18 0.04 0.01 0.01
p-value
 Linear < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05
 Quadratic < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05

1) Each value represents the mean of five repetitions (two broilers per repetition) (n = 5).

a–d Values with different superscripts are significantly different (p < 0.05).

Ca, calcium; P, phosphorus.

Download Excel Table
Table 5. Effects of dietary vitamin D3 concentration on femur development in 21-day-old broilers (experiment 2)1)
Vitamin D3 (IU/kg) Bone weight (g/bone) Bone length (cm/bone) Mineral percentage (%) Mineral weight (g/bone)
Ash Ca P Ash Ca P
0 0.81c 3.83b 35.5b 12.8b 6.91b 0.29c 0.10b 0.06c
125 1.22b 4.60a 46.7a 17.5a 8.98a 0.56b 0.21a 0.11b
250 1.33ab 4.66a 45.7a 17.6a 9.19a 0.60ab 0.23a 0.12ab
500 1.33ab 4.69a 47.5a 17.0a 9.15a 0.63ab 0.23a 0.12ab
1,000 1.43a 4.79a 46.8a 17.0a 8.97a 0.67a 0.24a 0.13a
2,000 1.43a 4.78a 45.9a 17.1a 8.84a 0.66a 0.24a 0.13a
SEM 0.04 0.07 0.8 0.3 0.16 0.03 0.01 0.005
p-value
 Linear < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05
 Quadratic < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05 < 0.05

1) Each value represents the mean of five repetitions (two broilers per repetition) (n = 5).

a–c Values with different superscripts are significantly different (p < 0.05).

Ca, calcium; P, phosphorus.

Download Excel Table
Gene expression levels of intestinal Ca and P transporters

The primary function of CaBP-D28k is to transfer Ca in intestinal cells. Compared with the negative control feed, supplementation with 125 IU/kg VD3 increased the mRNA abundance of intestinal CaBP-D28k in broilers (p < 0.05, Figs. 2A, 3A, and 4A). Increasing the VD3 level from 125 to 1,000 IU/kg enhanced the mRNA abundances of jejunal and ileal CaBP-D28k (p < 0.05). The mRNA levels of duodenal, jejunal, and ileal CaBP-D28k increased by 536, 1,161, and 28 folds, respectively, after adding 1,000 IU/kg VD3. No differences in the mRNA abundances of jenunal and ileal CaBP-D28k were detected between the broilers fed with 1,000 and 2,000 IU/kg VD3 (p > 0.05).

jast-65-2-336-g2
Fig. 2. Effects of dietary vitamin D3 concentration on the mRNA abundances of calcium and phosphorus transporters in the duodenum of 21-day-old broilers (experiment 2). (A) CaBP-D28k, calcium-binding protein 28-kDa (Linear p < 0.05, Quadratic p < 0.05); (B) PMCA1b, plasma membrane calcium ATPase 1b (Linear p < 0.05, Quadratic p < 0.05); (C) NCX1, sodium-calcium exchanger 1 (Linear p = 0.28, Quadratic p < 0.05); (D) NaPi-IIb, IIb sodium-dependent phosphate cotransporter (Linear p = 0.08, Quadratic p < 0.05); (E) PiT-1, inorganic phosphate transporter 1 (Linear p < 0.05, Quadratic p < 0.05); (F) PiT-2, inorganic phosphate transporter 2 (Linear p < 0.05, Quadratic p < 0.05). The values are the means of five repetitions (n = 5) and presented as mean ± SD. a–dValues with different superscripts are significantly different (p < 0.05).
Download Original Figure
jast-65-2-336-g3
Fig. 3. Effects of dietary vitamin D3 concentration on the mRNA abundances of calcium and phosphorus transporters in the jejunum of 21-day-old broilers (experiment 2). (A) CaBP-D28k, calcium-binding protein 28-kDa (Linear p < 0.05, Quadratic p < 0.05); (B) PMCA1b, plasma membrane calcium ATPase 1b (Linear p < 0.05, Quadratic p < 0.05); (C) NCX1, sodium-calcium exchanger 1 (Linear p < 0.05, Quadratic p = 0.81); (D) NaPi-IIb, IIb sodium-dependent phosphate cotransporter (Linear p = 0.34, Quadratic p = 0.28); (E) PiT-1, inorganic phosphate transporter 1 (Linear p = 0.15, Quadratic p < 0.05); (F) PiT-2, inorganic phosphate transporter 2 (Linear p = 0.49, Quadratic p = 0.40). The values are the means of five repetitions (n = 5) and presented as mean ± SD. a–cValues with different superscripts are significantly different (p < 0.05).
Download Original Figure
jast-65-2-336-g4
Fig. 4. Effects of dietary vitamin D3 concentration on the mRNA abundances of calcium and phosphorus transporters in the ileum of 21-day-old broilers (experiment 2). (A) CaBP-D28k, calcium-binding protein 28-kDa (Linear p < 0.05, Quadratic p < 0.05); (B) PMCA1b, plasma membrane calcium ATPase 1b (Linear p = 0.66, Quadratic p = 0.29); (C) NCX1, sodium-calcium exchanger 1 (Linear p = 0.80, Quadratic p = 0.87); (D) NaPi-IIb, IIb sodium-dependent phosphate cotransporter (Linear p = 0.94, Quadratic p < 0.05); (E) PiT-1, inorganic phosphate transporter 1 (Linear p < 0.05, Quadratic p = 0.86); (F) PiT-2, inorganic phosphate transporter 2 (Linear p < 0.05, Quadratic p < 0.05). The values are the means of five repetitions (n = 5) and presented as mean ± SD. a–dValues with different superscripts are significantly different (p < 0.05).
Download Original Figure

PMCA1b is responsible for Ca extrusion. Dietary VD3 levels upregulated the mRNA abundances of duodenal and jejunal PMCA1b (p < 0.05, Figs. 2B and 3B). The mRNA abundances of PMCA1b in the duodenum of broilers supplied with 250–1,000 IU/kg VD3 and that in the jejunum of broilers supplied with 500 IU/kg VD3 were higher than those in broilers provided with the negative control feed (p < 0.05). Dietary VD3 did not influence the mRNA abundance of ileal PMCA1b (p > 0.05, Fig. 4B).

NCX1 is a sodium and Ca exchanger. The broilers fed with 1,000 IU/kg VD3 had higher mRNA abundances of duodenal and jejunal NCX1 than those supplied with the negative control feed (p < 0.05, Figs. 2C and 3C). Dietary VD3 levels did not affect the mRNA abundance of ileal NCX1 (p > 0.05, Fig. 4C).

NaPi-IIb is the main P transporter. Dietary VD3 enhanced the mRNA abundances of intestinal NaPi-IIb (p < 0.05, Figs. 2D, 3D, and 4D). The mRNA abundance of NaPi-IIb was the highest in the duodenum of the broilers fed with 250 IU/kg VD3, in the jejunum of the broilers provided with 125 IU/kg VD3, and in the ileum of the broilers supplied with 500 IU/kg VD3 (p < 0.05).

PiT-1 is inorganic phosphate transporter 1. VD3 regulated the mRNA abundances of PiT-1 in the duodenum and jejunum (p < 0.05, Figs. 2E and 3E). The mRNA abundance of duodenal PiT-1 was enhanced after the addition of 250–1,000 IU/kg VD3 (p < 0.05), and that of jejunal PiT-1 was increased by 1,000 IU/kg VD3 (p < 0.05). On the contrary, the mRNA abundance of ileal PiT-1 was not affected by dietary VD3 (p > 0.05, Fig. 4E).

The function of PiT-2 is similar to that of PiT-1. The mRNA abundances of duodenal and ileal PiT-2 were enhanced by VD3 (p < 0.05, Figs. 2F and 4F). The mRNA abundance of PiT-2 was higher in the duodenum of the broilers fed with 250–500 IU/kg VD3 and in the ileum of the broilers supplied with 1,000–2,000 IU/kg VD3 than those of the broilers provided with the negative control feed (p < 0.05). The mRNA abundance of jejunal PiT-2 was not affected by VD3 (p > 0.05, Fig. 3F).

DISCUSSION

Experiment 1

The duodenum is the first segment of the small intestine, followed by the jejunum and ileum. The mRNA and protein abundances of duodenal CaBP-D28k and PMCA1b are higher than those in the two other segments in laying hens [10,17,25]. Our results were consistent with those of previous reports. The highest mRNA abundances of CaBP-D28k, PMCA1b, and NCX1 were noted in the duodenum of broilers in this research. Thus, the Ca transporters are mainly expressed in poultry duodenum. These data suggest that the capacity of active Ca absorption declines from the duodenum to ileum of poultry.

NaPi-IIb is the primary P transporter in mouse intestines [14]. The mRNA abundances of jejunal and ileal NaPi-IIb are lower than that of duodenal NaPi-IIb in broilers [16,26]. Similar results were observed in this research, and the highest mRNA abundance of NaPi-IIb existed in the duodenum. Thus, the ability of NaPi-IIb to transport P in the duodenum is higher than that in the jejunum and ileum of poultry. PiT-1 and PiT-2 play a smaller role in intestinal P absorption than NaPi-IIb [14]. The mRNA abundance of duodenal PiT-1 is lower than those of jejunal and ileal PiT-1 in laying hens [10]. The present research showed that the highest mRNA abundances of PiT-1 and PiT-2 were observed in the ileum of broilers. PiT-1 and PiT-2 may promote the P absorption in the distal segment of the small intestine of poultry.

Experiment 2
Growth performance

Dietary VD3 insufficiency decreases the growth rate of poultry [19]. In this research, the lowest BWG and FI were detected in the broilers provided with the negative control feed. Adding 125 IU/kg VD3 increased the FI and decreased the FCR of broilers. The BWG was increased with the addition of VD3 when more nutrients were retained in the body of broilers. Increasing VD3 concentration from 125 to 1,000 IU/kg significantly elevated the BWG. The recommended VD3 dosage by NRC is 200 IU/kg [2], which can not meet the requirement of broilers for growth rate. A further increase in VD3 level from 1,000 to 2,000 IU/kg did not improve broiler performance in this research. Similar results have been reported [27], in which increasing dietary VD3 level from 1,000 to 7,000 IU/kg does not influence the BW of 1–38-day-old broilers. Thus, it’s necessary to maintain the VD3 levels of broilers at 1,000–2,000 IU/kg.

Bone development

Ingested Ca and P cannot be effectively absorbed in the blood and deposited in bones of broilers when dietary VD3 is deficient [1]. The lowest Ca and P weights of the leg bones were noted in the broilers provided with the negative control feed in this research. The addition of 125 IU/kg VD3 increased the leg bone Ca and P contents. Ash includes Ca, P, and other minerals. The ash percentage and weight were elevated by the addition of VD3. Our results were in accordance with those reported by previous research [4]. The leg weight and length enhanced with the increase in bone mineral contents after adding 125–1,000 IU/kg VD3. Dietary 200 IU/kg VD3 given by NRC [2] can not meet the needs of bone development of broilers. No difference was noted in the bone quality of broilers provided with 1,000 and 2,000 IU/kg VD3 in this research. Thus, in order to support the leg bone growth and mineralization, 1,000–2,000 IU/kg VD3 should be added to the broiler diets.

Gene expression levels of intestinal Ca and P transporters

CaBP-D28k and CaBP-D9k are observed in poultry and mammal enterocytes, respectively. The present research showed that supplementation with 125–2000 IU/kg VD3 increased the mRNA abundance of CaBP-D28k in the three intestinal segments of broilers to varying degrees, especially in the jejunum. 1,25-(OH)2-D3, the final active form of VD3, increases mRNA abundance of intestinal CaBP-D28k in laying hens [28]. Thus, VD3 and 1,25-(OH)2-D3 stimulated CaBP-D28k gene transcription in the intestinal cells of poultry and contributed to the increase in leg bone Ca content. In addition, research in mammals has shown the positive effect of 1,25-(OH)2-D3 on the gene expression of intestinal CaBP-D9k [5].

PMCA1b is expressed in the basolateral membrane. The addition of 1,25-(OH)2-D3 enhances the mRNA abundance of duodenal PMCA1b in mice [29]. Similar results were noted in this research. The mRNA abundance of PMCA1b in the duodenum of broilers increased after adding 250–1,000 IU/kg VD3. Thus, optimal levels of VD3 upregulated PMCA1b gene expression and promoted Ca extrusion from intestinal cells into the blood. Notably, the addition of 2,000 IU/kg VD3 insignificantly affected intestinal PMCA1b mRNA level compared with the negative control diet.

Similar to PMCA1b, NCX1 also exists in the basolateral membrane. Dietary VD3 insufficiency leads to a decrease in the mRNA abundance of NCX1 in chick duodenum, which is increased after the injection of 1,25-(OH)2-D3 [30]. This research showed that adding 1000 IU/kg VD3 enhanced the mRNA abundance of duodenal and jejunal NCX1 by 0.67–1.74 folds. These data suggest that VD3 promoted the exchange of Ca and Na in intestinal cells and the blood.

NaPi-IIb, the major P transporter, is found in the apical membrane of rat intestinal cells [12,13]. This research showed that the mRNA abundance of NaPi-IIb in the three intestinal segments was increased by dietary VD3 to varying degrees. The effects of the VD3 on NaPi-IIb gene expression have been observed in broilers [31], in which a high VD3 dosage upregulates the mRNA abundance of intestinal NaPi-IIb compared with a low VD3 level. The addition of VD3 enhances the protein expression level of jejunal NaPi-IIb in broilers fed with P-insufficient feed [15]. Thus, VD3 stimulated NaPi-IIb gene expression and the active P absorption in broiler intestines.

PiT-1 is expressed in the apical membrane of rat enterocytes [13]. Compared with NaPi-IIb, PiT-1 plays a minor role in phosphate transport into the intestinal epithelial cells of mice [14]. Supplementation of 250–1,000 IU/kg VD3 increased the mRNA abundance of duodenal PiT-1 in this research. The addition of VD3 also enhanced the protein abundance of jejunal PiT-1 in broilers provided with P-inadequate diets [15]. These data reveal the positive effects of VD3 on intestinal PiT-1 gene transcription in broilers.

The gene expression of PiT-2 has been observed in the apical membrane of rodent intestinal cells [12,32]. PiT-2 involves P absorption in mouse intestines upon dietary P restriction [32]. This research showed that the addition of VD3 increased the mRNA abundances of duodenal and ileal PiT-2 in broilers. Thus, VD3 upregulated PiT-2 gene expression and promoted P transport in the apical membrane of broiler intestinal cells.

In conclusion, the highest mRNA abundances of CaBP-D28k, PMCA1b, NCX1, and NaPi-IIb were detected in the duodenum of broilers. On the contrary, the mRNA abundances of PiT-1 and PiT-2 in the duodenum were lower than those in the two other intestinal segments. Adding 125–2,000 IU/kg VD3 improved growth performance and leg bone quality of 1–21-day-old broilers. The mRNA level of CaBP-D28k increased by 536, 1,161, and 28 folds in the duodenum, jejunum, and ileum, respectively, after adding 1,000 IU/kg VD3. By contrast, the mRNA abundances of other Ca and P transporters (PMCA1b, NCX1, NaPi-IIb, PiT-1, and PiT-2) increased by 0.57–1.74 folds by supplementation with 1,000–2,000 IU/kg VD3.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This work was supported by the National Natural Science Foundation of China (32072753).

Acknowledgements

Not applicable.

Availability of data and material

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Authors’ contributions

Conceptualization: Han J, Wu L, Lv X, Xi L, Wang Z.

Data curation: Wu L, Lv X, Liu M, Zhang Y, He L, Hao J, Qu H.

Formal analysis: Han J, Wu L, Shi C, Tang F.

Methodology: Wu L, Lv X, Liu M, Zhang Y, He L.

Software: Han J, Wu L, Li Z, Qiao Y.

Validation: Han J, Wu L, Lv X, Liu M, Zhang Y, He L.

Writing - original draft: Han J, Wu L, Xi L.

Writing - review & editing: Han J, Wu L, Lv X, Liu M, Zhang Y, He L, Hao J, Xi L, Qu H, Shi C, Li Z, Wang Z, Tang F, Qiao Y.

Ethics approval and consent to participate

This study was conducted according to the guidelines of the experimental procedures and approved by the Animal Ethics Committee of Shangqiu Normal University (2020-1012), China.

REFERENCES

1.

Rama Rao SV, Raju MVLN, Reddy MR. Performance of broiler chicks fed high levels of cholecalciferol in diets containing sub-optimal levels of calcium and non-phytate phosphorus. Anim Feed Sci Technol. 2007; 134:77-88

2.

NRC [National Research Council]. Nutrient requirements of poultry. 9th rev. ed. Washington, DC: National Academy Press. 1994

3.

Ministry of Agriculture of the People’s Republic of China. Feeding standard of chicken (NY/T 33-2004). Beijing: China Agriculture Press. 2004

4.

Fritts CA, Waldroup PW. Effect of source and level of vitamin D on live performance and bone development in growing broilers. J Appl Poult Res. 2003; 12:45-52

5.

Song Y, Peng X, Porta A, Takanaga H, Peng JB, Hediger MA, et al. Calcium transporter 1 and epithelial calcium channel messenger ribonucleic acid are differentially regulated by 1,25 dihydroxyvitamin D3 in the intestine and kidney of mice. Endocrinology. 2003; 144:3885-94

6.

Xu H, Bai L, Collins JF, Ghishan FK. Age-dependent regulation of rat intestinal type IIb sodium-phosphate cotransporter by 1,25-(OH)2 vitamin D3. Am J Physiol Cell Physiol. 2002; 282:C487-93

7.

Fleet JC, Schoch RD. Molecular mechanisms for regulation of intestinal calcium absorption by vitamin D and other factors. Crit Rev Clin Lab Sci. 2010; 47:181-95

8.

Proszkowiec-Weglarz M, Angel R. Calcium and phosphorus metabolism in broilers: effect of homeostatic mechanism on calcium and phosphorus digestibility. J Appl Poult Res. 2013; 22:609-27

9.

Yang JH, Hou JF, Farquharson C, Zhou ZL, Deng YF, Wang L, et al. Localisation and expression of TRPV6 in all intestinal segments and kidney of laying hens. Br Poult Sci. 2011; 52:507-16

10.

Gloux A, Le Roy N, Brionne A, Bonin E, Juanchich A, Benzoni G, et al. Candidate genes of the transcellular and paracellular calcium absorption pathways in the small intestine of laying hens. Poult Sci. 2019; 98:6005-18

11.

Rousseau X, Valable AS, Létourneau-Montminy MP, Même N, Godet E, Magnin M, et al. Adaptive response of broilers to dietary phosphorus and calcium restrictions. Poult Sci. 2016; 95:2849-60

12.

Villa-Bellosta R, Sorribas V. Role of rat sodium/phosphate cotransporters in the cell membrane transport of arsenate. Toxicol Appl Pharmacol. 2008; 232:125-34

13.

Giral H, Caldas Y, Sutherland E, Wilson P, Breusegem S, Barry N, et al. Regulation of rat intestinal Na-dependent phosphate transporters by dietary phosphate. Am J Physiol Renal Physiol. 2009; 297:F1466-75

14.

Sabbagh Y, Giral H, Caldas Y, Levi M, Schiavi SC. Intestinal phosphate transport. Adv Chronic Kidney Dis. 2011; 18:85-90

15.

Shao Y, Wen Q, Zhang S, Lu L, Zhang L, Liao X, et al. Dietary supplemental vitamin D3 enhances phosphorus absorption and utilisation by regulating gene expression of related phosphate transporters in the small intestine of broilers. Br J Nutr. 2019; 121:9-21

16.

Liu SB, Hu YX, Liao XD, Lu L, Li SF, Zhang LY, et al. Kinetics of phosphorus absorption in ligated small intestinal segments of broilers. J Anim Sci. 2016; 94:3312-20

17.

Sugiyama T, Kikuchi H, Hiyama S, Nishizawa K, Kusuhara S. Expression and localisation of calbindin D28k in all intestinal segments of the laying hen. Br Poult Sci. 2007; 48:233-8

18.

Hemmingsen C, Staun M, Nielsen PK, Olgaard K. Separate effects of 1,25-dihydroxyvitamin D and calcium on renal calbindin-D28k and intestinal calbindin-D9k. Pharmacol Toxicol. 2002; 91:111-5

19.

Baker DH, Biehl RR, Emmert JL. Vitamin D3 requirement of young chicks receiving diets varying in calcium and available phosphorus. Br Poult Sci. 1998; 39:413-7

20.

Hall LE, Shirley RB, Bakalli RI, Aggrey SE, Pesti GM, Edwards HM. Power of two methods for the estimation of bone ash of broilers. Poult Sci. 2003; 82:414-8

21.

AOAC [Association of Official Analytical Chemists] of International. Official methods of analysis. 18th ed. Gaithersburg, MD: AOAC International. 2007

22.

Rutherfurd SM, Chung TK, Morel PC, Moughan PJ. Effect of microbial phytase on ileal digestibility of phytate phosphorus, total phosphorus, and amino acids in a low-phosphorus diet for broilers. Poult Sci. 2004; 83:61-8

23.

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001; 25:402-8

24.

SAS Institute. SAS user’s guide. Version 9.0. Cary, NC: SAS Institute. 2002

25.

Li P, Wang R, Jiao H, Wang X, Zhao J, Lin H. Effects of dietary phosphorus level on the expression of calcium and phosphorus transporters in laying hens. Front Physiol. 2018; 9:627

26.

Han JC, Zhang JL, Zhang N, Yang X, Qu HX, Guo Y, et al. Age, phosphorus, and 25-hydroxycholecalciferol regulate mRNA expression of vitamin D receptor and sodium-phosphate cotransporter in the small intestine of broiler chickens. Poult Sci. 2018; 97:1199-208

27.

Sakkas P, Smith S, Hill TR, Kyriazakis I. A reassessment of the vitamin D requirements of modern broiler genotypes. Poult Sci. 2019; 98:330-40

28.

Bar A, Striem S, Mayel-Afshar S, Lawson DEM. Differential regulation of calbindin-D28K mRNA in the intestine and eggshell gland of the laying hen. J Mol Endocrinol. 1990; 4:93-9

29.

van Abel M, Hoenderop JGJ, van der Kemp AWCM, van Leeuwen JPTM, Bindels RJM. Regulation of the epithelial Ca2+ channels in small intestine as studied by quantitative mRNA detection. Am J Physiol Gastrointest Liver Physiol. 2003; 285:G78-85

30.

Centeno V, Picotto G, Pérez A, Alisio A, Tolosa de Talamoni N. Intestinal Na+/Ca2+ exchanger protein and gene expression are regulated by 1,25(OH)2D3 in vitamin D-deficient chicks. Arch Biochem Biophys. 2011; 509:191-6

31.

Aye Cho TZ, Sadiq MB, Srichana P, Anal AK. Vitamin D3 enhanced intestinal phosphate cotransporter genes in young and growing broilers. Poult Sci. 2020; 99:2041-7

32.

Pastor-Arroyo EM, Knöpfel T, Inenez Silva PH, Schnitzbauer U, Poncet N, Biber J, et al. Intestinal epithelial ablation of Pit-2/Slc20a2 in mice leads to sustained elevation of vitamin D3 upon dietary restriction of phosphate. Acta Physiol. 2020; 230e13526

Revised Publication Charge


(Effective for articles submitted beginning January 1, 2026)

The publication charge is 1,500,000 Korean Won per article for members of the Korean Society of Animal Science and Technology (KSAST), and 2,000,000 Korean Won for non-members. First and corresponding authors are required to pay the annual membership fee.

The publication charge for a corresponding author outside Korea is 1,500 US dollars per article.


I don't want to open this window for a week.