RESEARCH ARTICLE

Marine-derived Ca-Mg complex influences lipid and glucose metabolism, serum metabolites, colostrum profile, and stress hormone in sows over four-parity periods

Sungbo Cho1,#https://orcid.org/0000-0002-2593-2758, Santi Devi Upadhaya1,#https://orcid.org/0000-0002-3801-4964, Woo Jeong Seok1https://orcid.org/0000-0002-1758-7579, Seyoung Mun2https://orcid.org/0000-0002-9669-4494, Haeun Lee3https://orcid.org/0000-0002-9415-0557, Rudolf H. van der Veen4https://orcid.org/0000-0003-1092-7961, Kyudong Han2,5,*https://orcid.org/0000-0001-6791-2408, In Ho Kim1,*https://orcid.org/0000-0001-6652-2504
Author Information & Copyright ▼
1Department of Animal Resource and Science, Dankook University, Cheonan 31116, Korea
2Center for Bio-Medical Engineering Core Facility, Dankook University, Cheonan 31116, Korea
3Department of Bioconvergence Engineering, Dankook University, Jukjeon 16890, Korea
4Celtic Sea Minerals, Strand Farm, Carrigaline, County Cork P43 NN62, Ireland
5Department of Microbiology, College of Science and Technology, Dankook University, Cheonan 31116, Korea
*Corresponding author: Kyudong Han, Center for Bio-Medical Engineering Core Facility, Dankook University, Cheonan 31116, Korea. Tel: +82-41-550-3567, E-mail: kyudong.han@gmail.com
*Corresponding author: In Ho Kim, Department of Animal Resource and Science, Dankook University, Cheonan 31116, Korea. Tel: +82-41-550-3652, E-mail: inhokim@dankook.ac.kr

# These authors contributed equally to this work.

© Copyright 2023 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Aug 30, 2023; Revised: Oct 20, 2023; Accepted: Oct 20, 2023

Published Online: Nov 30, 2023

Abstract

Minerals is required small amounts among various nutrients, but it has a significant impact on sow longevity and reproduction performance. This study was carried out to see the beneficial effects of marine-derived Ca-Mg complex on the reproductive performance of sows during four-parity periods. Seventy-two gilts ([Yorkshire × Landrace] × Duroc), with an average body weight of 181 kg, were randomly allocated to three groups; CON (basal diet), 0.3LC (CON - MgO - 0.3% limestone + 0.4% Ca-Mg complex), and 0.7LC (CON - MgO - 0.7% limestone + 0.4% Ca-Mg complex). During parity 3 and 4, the expression level of SCD gene was lower in the umbilical cord of piglets born to 0.3LC and 0.7LC sows compared with the CON sows. During parity 2, 3 and 4, SLC2A2 and FABP4 gene expressions were higher in the umbilical cord of piglets born to 0.7LC sows and the placenta of sows from 0.3LC groups, respectively. Ca-Mg complex increased (p < 0.05) Ca and Mg concentrations in sows and their piglets’ serum as well as in colostrum regardless of parities. The serum vitamin D concentration was higher (p < 0.05) in their first parity, whereas serum prolactin and estrogen concentrations were higher (p < 0.05) during the fourth and third parity, respectively. The growth hormone concentrations were higher (p < 0.05) in the piglets born to sows during the first and second parity. The fat and immunoglobulin A (IgA) concentrations in colostrum were higher (p < 0.05) during the third and fourth parity, respectively. A reduction (p < 0.05) in salivary cortisol, epinephrine, and norepinephrine concentrations was observed in 0.3LC and 0.7LC sow groups compared with CON after farrowing regardless of parity, however before farrowing, a reduction in norepinephrine was observed. Before farrowing, the epinephrine and norepinephrine concentrations were higher (p < 0.05) during the first and second parity. After farrowing, the concentration of these hormones was higher during the second parity. Taken together, sows’ parity and dietary Ca-Mg complex supplementation influenced serum metabolites, colostrum nutrients, stress hormones as well as the gene expressions related to lipid and glucose metabolism.

Keywords: Ca-Mg complex; Gene expression; Hormones and serum metabolites; Parity; Sow

INTRODUCTION

Among several factors, different nutritional regimens play a significant role in sow longevity through subsequent parities. In the past decade, the reproductive performance of high-producing sows has increased dramatically due to genetic improvements [1]. Thus, there may be alterations in the nutrient requirements of high-producing sows [2] that may affect hormone levels, immune markers, and colostrum nutrients, consequently affecting the reproduction performance of sows. A small amount of mineral requirements has huge impacts on sow longevity and reproduction performance. For instance, calcium (Ca) and phosphorus levels in the diet were well-known to influence reproduction and, sow longevity [3,4]. The inclusion of 0.015% to 0.03% magnecium (Mg) in sow diets showed positive effects on reproductive parameters and serum mineral contents [5]. The beneficial effect on components of sow longevity has been exhibited by other minerals too. However, Crenshaw [6] pointed out that the positive response of dietary measures was not achieved in minimzing sow mortality because of lameness caused by manipulation of bone mineralization.

A deficiency of minerals were often found in older sows who completed three parities compared to pregnant gilts [7,8]. The amounts of minerals including Ca and Mg in sows decline as the sow get aged. Therefore, The dietary mineral supplementation to sow is important and, the supplemented minerals should be highly soluble and bioavailable to them. In addition, an adequate nutrient supply to the placenta of sows is important for proper fetal development since the placenta has the feto-maternal interface coordinating maternal nutrient supply and fetal metabolic requirements [9,10]. The levels of maternal mineral and vitamin could affect hormonal regulatory pathway which links maternal metabolism and the feto-placental unit [11]. High Ca diets have been found to suppress calcitriol levels and it alters lipid and energy metabolism of umbilical cord and placenta in the sow [12–16]. Consequently, it influences lipid and energy metabolism in the developing fetus.

The common Ca resource, calcium carbonate, is not only derived from limestone or rock, but also from the calcified skeletal remains of the red marine algae, especially species Lithothamnion. The bioavailability of the marine-derived Ca and Mg complex is high [17] and, it has a porous honeycombed vegetative cell structure. The structure of the Ca-Mg complex provides beneficial effects on its chemical usage and absorption [18]. The limestone supplemented into the basal diet as a Ca source can be lowered by replacing it with a lower level of highly soluble and bioavailable Ca source without compromising the performance of the animals. To this end, the Ca-Mg complex was evaluated in the present study.

It was hypothesized that supplementing the basal diets with marine-derived Ca-Mg complex, which has increased bioavailability for gestating gilts in their first parity as well as gestating to lactating sows in the upcoming subsequent parities may enhance the serum contents of Ca, Mg, and vitamin D in sows and their progeny and reduce stress hormones, enrich colostrum composition in sows through four parities which would eventually improve sow longevity and performance. It was also hypothesized that supplementing marine-derived Ca-Mg Complex would affect placental and umbilical gene expression essential to lipid and energy metabolism, which may eventually affect fetal growth and development. Therefore, the objective of this study was to assess the effect of marine-derived Ca-Mg complex on lipid and glucose metabolism-associated gene expression, serum metabolites, colostrum nutrient profile, and stress hormones during the four successive parities of sows.

MATERIALS AND METHODS

The experimental protocol (DK-2-1927) for this study got consent from the Animal Care and Use Committee of Dankook University, Korea.

Experimental materials

The marine-derived Ca-Mg complex (27% Ca and 10% Mg) is a commercial product of Celtic Sea Minerals (Currabinny, Carrigaline, Co. Cork, Ireland).

Preparation of marine-derived mineral complex

As per the information of the manufacturing company, the mineral complex was harvested from seawater once the accumulated minerals in the Lithothamnion alga frond broke off and fell to the bottom of the sea. In order to produce a commercial marine-derived Ca-Mg complex for the feed industries, the mineralized fronds were sterilized, dried, and milled [19]. This mineral complex does not only contain Ca and Mg but, also includes 72 trace minerals such as strontium, manganese, selenium, copper, and zinc.

Experimental design, animals, housing, and diets

The animal trials were carried out from June 2019 to March 2021 at Dankook University swine farm, Cheonan, Korea. A total of 72 crossed-bred gilts ([Yorkshire × Landrace] × Duroc), average body weight of 181 kg were used. From the first pregnancy the gilts were randomly allocated to three groups. There were 24 gilts per treatment diet. The treatment diets were 0.3LC (basal diet – MgO − 0.3% limestone + 0.4% marine-derived Ca-Mg complex), and 0.7LC (basal diet - MgO - 0.7% limestone + 0.4% marine-derived Ca-Mg complex. Due to the limitations of the facility and workforce, 72 gilts were unable to start the trial at the same time. Thus, the gilts were subdivided into three rounds (round 1, 2, and 3) with 8 gilts per treatment per round. Each group in the rounds was continuously provided with the treatment diets up to the subsequent four parities. As recommended by National Research Council [20], sows were given basal diets to meet or exceed the nutrient requirements during gestation and lactation (Tables 1 and 2). The treatment diets were provided to sows until the end of lactation during each successive parity, which was 135 days. From the first day of gestation, the individual body weight and backfat thickness of all sows were regularly recorded to check their condition during the trial. All sows were kept in fully slatted individual farrowing crates (2.10 × 1.80 m) for 107 days of gestation. Sows freely access to water from a drinker. Sows were not offered feed on the day of parturition. The temperature inside the farrowing house was kept at around 20°C. After the farrowing, a lactation diet was gradually increased for four days, and then sows were given ad libitum intake until the weaning day of their piglets, the 21st day.

Table 1. Ingredient composition of experimental gestation diets (as-fed basis)
Items Gestation
CON1) 0.3LC 0.7LC
Ingredients (%)
 Corn 49.02 48.93 49.33
 Soybean meal (48%) 4.22 4.25 4.06
 Soybean oil 2.06 2.10 1.89
 Dehulled soybean meal 5.94 5.94 5.94
 Palm kernel meal 2.00 1.94 2.3
 Wheat 24.41 24.41 24.41
 Wheat bran 3.30 3.30 3.33
 Soybean hull 2.20 2.20 2.20
 Molasses 3.25 3.25 3.25
 Mono-calcium phosphate 0.80 0.80 0.80
 Limestone 1.39 1.09 0.69
 MgO 0.02 - -
 Salt 0.50 0.50 0.50
 Methionine (99%) 0.01 0.01 0.01
 Threonine (100%) 0.09 0.09 0.09
 L-Lysine (78%) 0.23 0.23 0.24
 Vitamin / mineral premix2) 0.40 0.40 0.40
 Choline (25%) 0.15 0.15 0.15
 Phytase 0.01 0.01 0.01
 Ca-Mg complex - 0.40 0.40
Calculated composition
 ME (kcal/kg) 3,200 3,200 3,200
Analyzed composition (%)
 DM 88.5 89.1 88.6
 CP 12.8 13.0 12.9
 Fat 4.40 4.44 4.24
 Ca 0.78 0.77 0.62
 P 0.51 0.49 0.50
 Mg 0.19 0.19 0.19
 Lys 0.71 0.72 0.70
 Met 0.21 0.20 0.22

1) CON, Basal diet; 0.3LC, Basal diet - MgO - 0.3% limestone + 0.40% marine-derived Ca-Mg complex; 0.7LC, basal diet - MgO - 0.7% limestone + 0.40% marine-derived Ca-Mg complex.

2) Provided per kg of complete diet: 16,800 IU vitamin A; 2,400 IU vitamin D3; 108 mg vitamin E; 7.2 mg vitamin K; 18 mg riboflavin; 80.4 mg niacin; 2.64 mg thiamine; 45.6 mg D-pantothenic; 0.06 mg cobalamine; 12 mg Cu (as CuSO4); 60 mg Zn (as ZnSO4); 24 mg Mn (as MnSO4); 0.6 mg I (as Ca(IO3)2; 0.36 mg Se (as Na2SeO3).

ME, metabolizable energy; DM, dry matter; CP, crude protein; Lys, lysine; Met, methionine.

Download Excel Table
Table 2. Ingredient composition of experimental lactation diets (as-fed basis)
Items Lactation
CON1) 0.3LC 0.7LC
Ingredients (%)
 Corn 41.08 40.94 41.19
 Soybean meal (48%) 4.02 4.03 3.96
 Soybean oil 3.21 3.26 3.08
 Dehulled Soybean meal 12.96 12.96 12.96
 Wheat 23.00 23.00 23.00
 Wheat bran 8.31 8.31 8.31
 Rice bran 2.00 2.00 2.00
 Molasses 2.00 2.00 2.40
 Mono-calcium phosphate 0.59 0.59 0.59
 Limestone 1.43 1.13 0.73
 MgO 0.02 - -
 Salt 0.50 0.50 0.50
 Threonine (100%) 0.05 0.05 0.05
 L-Lysine (78%) 0.30 0.30 0.30
 Vitamin / mineral premix2) 0.40 0.40 0.40
 Choline (25%) 0.12 0.12 0.12
 Phytase 0.01 0.01 0.01
 Ca-Mg complex - 0.40 0.40
Calculated composition
 ME (kcal/kg) 3,300 3,300 3,300
Analyzed composition (%)
 DM 88.8 88.1 89.0
 CP 16.3 16.5 16.4
 Fat 5.76 5.81 5.64
 Ca 0.74 0.75 0.60
 P 0.51 0.53 0.56
 Mg 0.25 0.25 0.25
 Lys 0.92 0.90 0.89
 Met 0.20 0.23 0.21

1) CON, Basal diet; 0.3LC, Basal diet - MgO - 0.3% limestone + 0.40% marine-derived Ca-Mg complex ; 0.7LC, basal diet - MgO - 0.7% limestone + 0.40% marine-derived Ca-Mg complex.

2) Provided per kg of complete diet: 16,800 IU vitamin A; 2,400 IU vitamin D3; 108 mg vitamin E; 7.2 mg vitamin K; 18 mg riboflavin; 80.4 mg niacin; 2.64 mg thiamine; 45.6 mg D-pantothenic; 0.06 mg cobalamine; 12 mg Cu (as CuSO4); 60 mg Zn (as ZnSO4); 24 mg Mn (as MnSO4); 0.6 mg I (as Ca(IO3)2); 0.36 mg Se (as Na2SeO3).

ME, metabolizable energy; DM, dry matter; CP, crude protein; Lys, lysine; Met, methionine.

Download Excel Table
Sampling, measurements, and chemical analysis
Feed analysis

Feed samples were dried in an oven (Daihan Scientific, Seoul, Korea), maintaining the temperature of 70°C for 72 hours and finely ground to pass through a 1-mm screen. The feed samples were duplicated for dry matter (DM;method 930.15), crude protein (N×6.25; method 988.05), crude fat (method 954.02), Ca (method 984.01), P (method 965.17), Mg (method 968.08), and amino acids (method 982.30E) analysis, which is followed by the procedure from the Association of Official Analytical Chemists International [21].

RNA extraction process

For the gene expression study, the tissue of the placenta and umbilical cord from five randomly selected animals per treatment were collected immediately after farrowing, and RNA was isolated from these tissues and stored at −80°C until analysis. The RNA extraction was carried out by Trizol methods using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and a Taco™Prep homogenizer (GeneReach Biotechnology, Taichung, Taiwan). Immediately after RNA extraction, quality and the quantity of total RNA were determined spectrophotometrically using an ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA). Then, We synthesised cDNA using the ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan) and a thermocycler (Bio-Rad Laboratories, Berkeley CA, USA) at the Center for Biomedical Engineering Core Facility (Dankook University, Cheonan, Korea).

Quantification of gene expression using quantitative real-time-polymerase chain reaction

The treatment-dependent gene expression levels for FABP4, CD36, SCD, FAS, SLC2A2 (primers shown in Table 3) were quantified by RT-qPCR and compared between CON and 0.3LC or 0.7LC. As a housekeeping gene, a primer pair of glycerol aldehyde-3-phosphate dehydrogenase (GAPDH) of Sus scrofa (ENSSSCG00000000694). A positive RT-qPCR reaction was detected by CFX96 Real-Time PCR System (Bio-Rad Laboratories). The relative gene expression levels were determined by 2−ddCT method. For each cDNA sample, RT-qPCR validation was performed in triplicates.

Table 3. The detailed information of primers for real-time PCR
Gene Forward Reverse Size Gene bank ID
SLC2A2 GGCTGAGGAAGAGACTACGG TCTTCCAAGCCGATCTCCAA 130 ENSSSCT00000010450.4
FAS TCACTGGTATTTACCTGTATCG GGGCACTCAGACTCCCTT 116 ENSSSCT00005025850.1
FABP ATAACCTTAGATGGAGGCGC CCACCACCAACTTATCATCT 97 ENSSSCG00000040681
CD36 TCCTACAGCCCAATGGTGCC CAGCTGCCACAGCCAGATTGAG 93 ENSSSCP00000016332
SCD GGAGAAACATCATCCTCATG GCCCAGAGCAAGGTGTATAT 94 ENSSSCG00000010554

PCR, polymerase chain reaction.

Download Excel Table
Serum parameters in sows and piglets

Blood samples (5 mL) were collected via jugular venipuncture from 5 sows per treatment group (i.e., three groups, n =15) and two piglets per representative sow (n =30) during each successive parity, 12 hours after parturition, into vacuum tubes without additives. The serum was centrifuged for 15 min at 3,000×g at 4°C and stored at −20°C until serum Ca, Mg, vitamin D, estrogen, cortisol, growth hormone, and prolactin concentrations. Ca and Mg in the serum were analyzed using the calorimetry method with the help of Cobas C702 (Roche Diagnostics, Mannheim, Germany). Serum vitamin D was measured using Elecsys vitamin D total chemiluminescence binding assay (Roche Diagnostics) with a Cobas 8000 e602 analyzer (Roche Diagnostics). The analysis of serum estrogen was done using an RIA kit (MP Biochemical) and detected with the help of 1479 WIZARD Gamma counter (Perkin Elmer, Massachusett, Waltham, USA). Prolactin was measured using a chemiluminescence Binding Assay (Roche Diagnostics) with a Cobas E801 analyzer (Roche Diagnostics). The growth hormone in the blood was analyzed using a growth hormone CLIA kit and detected with the help of IMMULITE ® 2000XPi (Siemens, Washington, DC, USA).

Colostrum contents

About 30 mL of colostrum were collected manually from the same mammary glands (first, third, and fifth teat on both sides) of five representative sows in each group (n = 15 per treatment) within five hours postpartum into a sterilized 50 ml falcon tube and mixed thoroughly at each parity. The collected colostrum samples were kept in an icebox, transported to the laboratory, and stored at −20°C until further analyses. Colostrum concentrations of IgG, IgA, and IgM were assayed using specific ELISA kits (Abnova, Taipei, Taiwan) and run according to the manufacturer’s instructions. The determination of fat was done using the Rose-Gottlieb method [22]. Protein, Ca, and Mg were performed according to the methods outlined by the Association of Official Agricultural Chemists International [21]; protein, using the Kjeldahl method (N × 6.32); Ca, and Mg, by the spectrophotometric method.

Stress hormones in sows

Saliva was collected before and after 5 hours of farrowing from 5 sows per treatment group (i.e., three groups, n =15 per treatment) during each parity. The sows were allowed to chew on the rope for 30 minutes, and the saliva from the cotton rope was squeezed into falcon tubes and stored at −20°C until analysis. The cortisol, epinephrine, and norepinephrine concentrations in saliva were determined by ELISA kit (catalog no. KA1885, KA 1882, and KA1891 respectively, Abnova, Taipei, Taiwan) as per manufacturer’s instructions.

Statistical analyses

For gene expression, data were analyzed using the MIXED procedure of SAS ( v.9.3, SAS Institue, Cary, NC, USA) for each parity separately. The data for other indices were analyzed as a 4×3 factorial arrangement. Two-way analysis of variance (ANOVA) was used to assess the parity effect (four successive parities), and three dietary treatments (with/without supplemental marine-derived Ca-Mg complex) during gestation to lactation, as well as possible interactions between these variables. The means of the data were presented with the SEM and a probability (p) level lower than 0.05 was considered a significant difference among the groups, p < 0.01 or < 0.001 indicated a highly significant difference.

RESULTS

Validation of gene expression differences

The effect of marine-derived Ca-Mg complex on relative mRNA expression of SLC2A2, FAS, SCD, CD36, and FABP4 genes in the placenta and umbilical cord during parity 1 to 4 is presented in Fig. 1. During parity 1, the relative mRNA expression of these genes in the placenta and umbilical cord was not affected by supplementing the sow diets with Ca-Mg complex. During parity 3 and 4, the relative expression of the SCD gene was significantly downregulated (p < 0.01) in the umbilical cord of piglets born to 0.3LC and 0.7LC sows compared with the CON counterpart. From the second parity, the expression of the SLC2A2 (p < 0.003) gene was upregulated in both the placenta of 0.7LC sow and the umbilical cord of piglets born from 0.7LC sows compared with CON and 0.3LC groups, and the expression of FABP4 (p < 0.043) gene was upregulated in the placenta of 0.3LC sows compared with CON and 0.7LC sows.

jast-65-6-1308-g1
Fig. 1. Effect of Ca-Mg complex (CM) supplements on relative mRNA expression of genes (SLC2A2, FAS, SCD, CD36, and FABP4) in the placenta and umbilical cord of swine from parity 1 to parity 4. The relative gene expression was calculated using the delta-delta Ct method with GAPDH as the endogenous control and the average delta-Ct value for the control sows on each day as the calibrator. CM1 means 0.3% limestone + 0.4% Ca-Mg complex. CM2 means 0.7% limestone + 0.4% Ca-Mg complex. a,bIndicate in the different letters were significantly different between CM1 and CM2 (p < 0.05). *Indicates the significantly different expression level com-pared to the control (p < 0.05). GAPDH, glycerol aldehyde-3-phosphate dehydrogenase.
Download Original Figure
Serum parameters in sows and piglets

The impact of dietary supplementation of marine-derived Ca-Mg complex on the hormones, Ca, Mg, and vitamin D concentrations in the serum of sows and their piglets during four successive parities is shown in Table 4. The inclusion of Ca-Mg complex in the sows’ diet increased (p < 0.05) serum Ca and Mg concentrations in sows and their piglets regardless of parities. However, the serum vitamin D, prolactin, and estrogen concentrations in sows and serum growth hormones in piglets were not affected by the inclusion of the Ca-Mg complex in sows’ diet. The serum vitamin D concentration tends to be higher (p < 0.1) during the first parity, whereas serum prolactin and estrogen concentrations were higher (p < 0.05) during the fourth and third parity, respectively. The lower levels of serum Ca in sows were observed at the fourth parity compared with the first parity. The lowest growth hormone concentration was (p < 0.05) in the piglets born to sows during the fourth parity. The growth hormone concentration was gradually reduced by continuous parities.

Table 4. The effect of dietary supplementation of marine-derived Ca-Mg complex on blood profile of sows and their progeny through four parities
Items Parity 1 Parity 2 Parity 3 Parity 4 SEM p-value
CON1) 0.3LC 0.7LC CON 0.3LC 0.7LC CON CC1 0.7LC CON 0.3LC 0.7LC Parity Trt P × T
Sow
 Calcium (mg/dL) 9.7A 9.9 9.8 9.6AB 9.8 9.8 9.5ABb 9.8a 9.7ab 9.4Bb 9.9a 9.9a 0.090 ‡ *** NS
 Magnesium (mg/dL) 2.70 2.84 2.81 2.67b 2.85a 2.84a 2.68b 2.84a 2.83a 2.55b 2.78a 2.79a 0.037 * *** NS
 Vitamin D (ng/mL) 64.99 63.24 68.38 61.79 63.13 61.26 63.33 62.22 62.81 62.36 62.64 62.96 1.727 ‡ NS NS
 Prolactin (ng/mL) 0.07B 0.06 0.06 0.07B 0.08 0.07 0.06B 0.07 0.07 0.09A 0.08 0.08 0.005 *** NS NS
 Estrogen (pg/mL) 42.2C 44.5 49.2 53.0B 54.5 50.2 60.1A 56.4 61.1 55.1AB 60.6 57.4 2.908 *** NS NS
Piglets
 Calcium (mg/dL) 10.9A 11.4 11.2 10.7AB 11.0 10.9 11.0A 11.3 11.3 10.5Bb 10.9a 11.0a 0.125 *** *** NS
 Magnesium (mg/dL) 3.46B 3.69 3.60 3.62A 3.78 3.74 3.68A 3.79 3.79 3.60ABb 3.78a 3.81a 0.060 ** *** NS
 Growth hormone (ng/mL) 0.056AB 0.059 0.056 0.060A 0.060 0.060 0.050B 0.060 0.060 0.040C 0.040 0.040 0.004 *** NS NS

1) CON, Basal diet; 0.3LC, Basal diet - MgO - 0.3% limestone + 0.40% marine-derived Ca-Mg complex; 0.7LC, basal diet - MgO - 0.7% limestone + 0.40% marine-derived Ca-Mg complex.

a,b Different superscripts within a row indicate a significant difference (p < 0.05) in response to treatment diets CON vs 0.3LC and 0.7LC.

A–C Different superscripts within a row indicate a significant difference (p < 0.05) among parity.

‡ p < 0.1,

* p < 0.05,

** p < 0.01,

*** p < 0.001.

P × T, interactive effects between parity and dietary treatments; NS, non-significant.

Download Excel Table
Nutrient contents in colostrum

The effect of the marine-derived Ca-Mg complex on the nutrient contents of colostrum in sows during four successive parities is presented in Table 5. The inclusion of the Ca-Mg complex led to higher (p < 0.05) Ca and Mg concentrations, and trends in higher protein and IgM concentrations were also observed regardless of parities. The fat and IgA concentrations in colostrum were higher (p < 0.05) during the third and fourth parity, respectively. A trend in higher Ca concentration was observed during the third parity. However, Mg, protein, IgG, and IgM concentrations in colostrum were not affected by parity.

Table 5. The effect of dietary supplementation of marine-derived Ca-Mg complex on colostrum profile of sow through four parities
Items Parity 1 Parity 2 Parity 3 Parity 4 SEM p-value
CON1) 0.3LC 0.7LC CON 0.3LC 0.7LC CON 0.3LC 0.7LC CON 0.3LC 0.7LC Parity Trt P × T
Calcium (mg/100 mL) 84.88 89.81 88.22 84.77 87.64 87.46 87.36b 91.2a 88.51b 84.87b 88.31a 87.69a 1.194 ‡ *** NS
Magnesium (mg/100 mL) 8.29b 8.75a 8.80a 8.27b 8.7a 8.73a 8.22b 8.71a 8.57ab 8.41 8.70 8.69 0.139 NS *** NS
Fat (%) 4.41B 4.41 4.35 4.45B 4.49 4.44 4.83A 4.69 4.73 4.55AB 4.48 4.46 0.109 ** NS NS
Protein (%) 18.32 19.13 18.99 18.58 18.65 18.90 18.50 18.64 18.63 18.65 18.58 18.64 0.179 NS ‡ NS
IgA (g/L) 7.99B 8.21 8.25 8.04B 8.17 8.30 8.27AB 8.35 8.39 8.46A 8.50 8.37 0.128 * NS NS
IgG (g/L) 47.44 48.88 49.21 48.34 48.79 48.87 48.59 48.53 49.23 48.83 48.83 48.71 0.544 NS NS NS
IgM (g/L) 3.62 3.80 3.78 3.73 3.82 3.69 3.71 3.73 3.59 3.76 3.78 3.68 0.062 NS ‡ NS

1) CON, Basal diet; 0.3LC, Basal diet - MgO - 0.3% limestone + 0.40% marine-derived Ca-Mg complex; 0.7LC, basal diet - MgO - 0.7% limestone + 0.40% marine-derived Ca-Mg complex.

a,b Different superscripts within a row indicate a significant difference (p < 0.05) in response to treatment diets CON vs. 0.3LC and 0.7LC.

A,B Different superscripts within a row indicate a significant difference (p < 0.05) among parity.

‡ p < 0.1,

* p < 0.05,

** p < 0.01,

*** p < 0.001.

P × T, interactive effects between parity and dietary treatments; NS, non-significant.

Download Excel Table
Stress hormone concentrations in sows’ saliva before and after farrowing

The effect of supplementation of marine-derived Ca-Mg complex to sows’ diets on salivary stress hormone levels before and after farrowing during four successive parity is shown in Table 6. The inclusion of marine-derived Ca-Mg complex in sows’ diets significantly reduced (p < 0.05) cortisol, epinephrine and norepinephrine concentrations compared with CON regardless of parity in sows after farrowing, however before farrowing, except for the reduction in norepinephrine, cortisol and epinephrine concentrations were not significantly affected by the inclusion of Ca-Mg complex in the diets. Before farrowing, the epinephrine concentrations were higher (p < 0.05) during the first and second parities than the third and fourth parities. The level of norepinephrine was significantly lower in the fourth parity compared to other parities. After farrowing, the levels of epinephrine and norepinephrine during the second parity showed the highest levels and, the cortisol levels of the second and third parities was higher (p < 0.05) than the other two parities. There were no interactive effects between parity and dietary treatments on salivary stress hormones, serum parameters, and the nutrient contents of colostrum.

Table 6. The effect of dietary supplementation of marine-derived Ca-Mg complex on saliva stress hormones in sows through four parities
Items (ng/mL) Parity 1 Parity 2 Parity 3 Parity 4 SEM p-value
CON1) 0.3LC 0.7LC CON 0.3LC 0.7LC CON 0.3LC 0.7LC CON 0.3LC 0.7LC Parity Trt P × T
Before farrowing
 Cortisol 1.00 0.82 0.84 1.11 0.95 0.91 0.97 0.96 1.08 0.82 0.83 1.07 0.119 NS NS NS
 Epinephrine 0.86A 0.84 0.82 0.92A 0.9 0.87 0.59B 0.67 0.58 0.57B 0.69 0.57 0.066 *** NS NS
 Norepinephrine 0.96ABa 0.72b 0.67b 1.11Aa 0.92b 0.76b 0.92ABa 0.73b 0.71b 0.90Ba 0.73b 0.69b 0.063 ** *** NS
After farrowing
 Cortisol 1.27Ba 0.83b 0.88b 1.8Aa 1.37b 1.32b 1.69Aa 1.27b 1.3b 1.29Ba 0.87b 0.83b 0.098 *** *** NS
 Epinephrine 0.86Ba 0.65b 0.56b 1.12A 0.87 0.71 0.88Ba 0.61b 0.56b 0.94ABa 0.63b 0.58b 0.068 *** *** NS
 Norepinephrine 0.80AB 0.79 0.67 0.98A 1.0 0.89 0.68B 0.72 0.61 0.68B 0.75 0.6 0.069 *** * NS

1) CON, Basal diet; 0.3LC, Basal diet - MgO - 0.3% limestone + 0.40% marine-derived Ca-Mg complex; 0.7LC, basal diet - MgO - 0.7% limestone + 0.40% marine-derived Ca-Mg complex.

a,b p Different superscripts within a row indicate a significant difference (p < 0.05) in response to treatment diets CON vs. 0.3LC and 0.7LC.

A,B pDifferent superscripts within a row indicate a significant difference (p < 0.05) among parity.

* p < 0.05,

** p < 0.01,

*** p <.001.

P × T, interactive effects between parity and dietary treatments; NS, non-significant.

Download Excel Table

DISCUSSION

Expression of lipid and glucose-metabolism associated genes as affected by marine-derived Ca-Mg complex over a four-parity period

Placental metabolism and transport play an influential role in fetal nutrition and metabolism since they determine the availability of nutrients to the fetus [23,24]. The compromised placental function inevitably has both short- and long-term consequences for the developing conceptus. Abnormal lipid transport during pregnancy can cause adverse impacts on the fetus. Previous studies reported that different Ca levels in the diet can affect glycolipid metabolism [25]. The aim of current study is to evaluate the partial replacement of limestone in the basal diet with marine-derived Ca-Mg complex for four successive parities. The expression levels of certain genes (FAS, CD36, FABP4, SCD) related to lipid metabolism and glucose transporter (SLC2A2) in the placenta and umbilical cord were tested. Among these genes, the mRNA expression of stearoyl-CoA desaturase (SCD) genes was downregulated in the umbilical cord of piglets born to 0.3LC and 0.7LC sows compared with CON in parity 3 and 4. There is a strong link between obesity, insulin resistance, and the SCD1 gene [26]. SCD1 catalyzes the synthesis of monounsaturated fatty acids (FAs) from saturated FAs. It has been reported that the activity of maternal and fetal SCD1 are associated with infant adiposity and negative correlations with carbohydrates and fat intakes in sows [27]. Although the specific roles of SCD1 in the umbilical cord have not been reported, the deficiency of SCD1 decreases lipogenesis and elevates lipolysis [26,27], which results in an increase of energy content. Thus, the downregulation of the SCD1 gene in the umbilical cord with the supplementation of Ca-Mg complex to sow diets potentially elevates energy transportation to the piglet, which in turn, benefits to the development of a fetus during the sow’spregnancy. Subsequently, it could increase the birth weights of the piglets. In a human study, Wang et al. [28] demonstrated that FABP4 might have an essential role in embryonic implantation and the maintenance of pregnancy, and its deregulation may result in pregnancy loss. The upregulation of FABP4 genes in the placenta from 0.3LC sow groups in the present study during the fourth parity indicated that sows were able to establish and maintain pregnancy even during the later parity stage. Additionally, FABP4 is involved in the regulation of glucose metabolism. Glucose is particularly important among the nutrients supplied by maternal circulation because it is the principal energy substrate for the developing fetus. The main regulatory factor in glucose transfer across the placenta is the activity of specific glucose transporters, the members of the GLUT family such as SLC2A. Although the SLC2A2 is important for the control of plasma membranes for glucose trnaport [29]. For gestating swine, glucose and insulin management are important to minimize embryo and fatal losses. Constant levels of glucose and insulin in sows could inhibit the hunger caused by limited feeding and, consequently, increase the physiological condition and activity of sows. The upregulation of SLC2A2 in the umbilical cord in piglets from the 0.7LC group during the fourth parity may indicate that progenies from Ca-Mg complex treated sows have reduced a risk of suppression in glucose uptake and glucose-stimulated insulin secretion.

Marine-derived Ca-Mg complex effects on serum metabolites, colostrum contents, and stress hormones

Due to increased requirements of the developing fetal skeleton for mineralization in late pregnancy, the need for Ca, Mg, and vitamin D increases for all mammals. Therefore, with the progress in gestation, the maternal needs for Ca, Mg, and vitamin D increase more specifically in the highly prolific sows. Earlier studies on the effects of dietary Mg levels on serum Mg levels in swine are inconsistent. For instance, in a previous study by Zang et al. [5], it was reported that the serum Mg and Ca levels in farrowing sows were linearly increased, in addition to a linear increase in serum Mg levels, growth hormone levels in nursing progeny from sows or gilts receiving the supplementation of 0.015% and 0.03% Mg in their diets. In contrast, supplemental magnesium exerted an adverse effect on serum magnesium levels in growing and finishing pigs [30]. However, Nuoranne et al. [31] indicated that the serum Mg level is not a reliable index of body magnesium status. In the present study, the serum Ca and Mg concentrations in sows and their piglets were higher in gilt/sow groups receiving marine-derived Ca-Mg complex supplemented diets than those receiving CON diets. However, the serum vitamin D, in gilts/sows was not affected by Ca-Mg complex supplementation to the gestation and lactation diets in the present study. The disparity in the findings among different studies may be due to the concentration and bioavailability, as well as the single or combined supplementation of Mg or Ca to the animals.

The hormone prolactin is known to induce the mammary gland to produce milk [32]. In the present study, serum prolactin and estrogen levels in sows and the growth hormone level in the progeny born to sows receiving Ca-Mg complex-supplemented diets were not affected, indicating the supplementation of these minerals had no adverse effects on these hormone levels.

Colostrum is a complex biological fluid containing a number of nutrients and protective factors that play a pivotal role in the early gastrointestinal development of suckling piglets [33]. The colostrum intake by the suckling piglets positively influences the growth, health, and survival of piglets because it provides passive immunity derived from maternally transmitted immunoglobulin [34–36]. In the present study, the colostrum obtained from sows fed Ca-Mg complex had higher concentrations of Ca, Mg, protein, and IgM suggesting the efficacy of supplemental minerals in enhancing the minerals, protein, and immunoglobulin content of colostrum which will eventually have a positive effect in their piglets’ health and performance. The pigs receiving dietary Mg aspartate have been reported to have reduced stress hormones such as cortisol and catecholamine, and a reduction in plasma epinephrine was observed in finishing pigs receiving Mg five days prior to slaughter [37]. The findings of the present study also showed a significant reduction in salivary stress hormones (cortisol, epinephrine, and norepinephrine) after farrowing regardless of parity suggesting the effectiveness of Ca-Mg complex supplementation in calming the animals. Thus, the reduction in stress hormones after farrowing in 0.3LC and 0.7LC sows may indicate a positive effect on sow recovery which may impact subsequent farrowing positively.

Parity effects on serum metabolites, colostrum contents, and stress hormones

The serum Mg level was significantly lower, and serum Ca and vitamin D levels tended to be low in the fourth parity sow. The levels of serum Ca and Mg were lower in the litters born to fourth parity sows compared with other parities suggesting that with the increase in parity, the mineral and vitamin levels get lower. Mahan and Taylor-Pickard [8] suggested that with the advancement in parity, the minerals stored in the body get depleted. The serum prolactin level in sows was found to be higher in fourth parity sows. In agreement with the present findings, Famer et al. [38], and Quesnel et al. [39] also demonstrated that prolactin concentration was lower in primiparous than multiparous sows at 24 h post-partum, which could be due to the increased need for the induction of higher milk production in multiparous sows due to more litter number than primiparous sows. The higher estrogen levels in the control group of the third and fourth parities in the present study may be due to the maturation of the reproductive system.

Previous studies reported variations in colostrum components, including fat, immunoglobulin, fat content, and growth factors between multiparous and primiparous sows [40,41]. For instance, colostrum fat was highest in primiparous sows, which declines as parity advances [39,42]. However, in the present study, the fat content of colostrum was the highest for the third parity sows, and the IgA level was the highest in the fourth parity sows among the other three parities. In contrast, no parity effect was observed on colostrum fat content [43] and IgA levels [42]. The protein levels in colostrum were not affected by the parity, which corroborated with Segura et al. [42]. The discrepancies in these findings are influenced by animal breed [41].

Sows in farms are regularly exposed to stressors throughout their production period, and the level of stress could be influenced by sows’ parities [44,45]. In the present study, the stress-related hormones analyzed from sows’ saliva were higher in first and second parity sows than in third and fourth parity sows. The reduction in stress hormones in sows during the third and fourth parity may be due to the ability to cope with stressors as they gain experience with them.

CONCLUSION

The inclusion of marine-derived Ca-Mg complex in the sow diet led to the downregulation of SCD gene during the third and fourth parities indicating that lipid metabolism was unaffected in the sows reducing the risk of obsessing newborns. Whereas the upregulation of FABP4 gene in the placenta of 0.3LC sows and SLC2A2 gene in the umbilical cord of piglets born to 0.7LC sows indicate that sows could establish and maintain the pregnancy even during the advanced parity stage, and their progenies had a reduced risk of suppression in glucose uptake and glucose-stimulated insulin secretion. The partial replacement of limestone in the basal diet of sows with marine-derived Ca-Mg complex significantly increased the serum Ca and Mg, colostrum Ca, Mg, protein, IgM levels, and reduced stress hormones after farrowing compared to sows fed control diet regardless of parity. However, depletion of Ca and Mg was observed in the fourth parity sows fed the control diet, and a reduction in stress hormones was observed in the third and fourth parity sows suggesting the need to continue supplementing the diet with bioavailable Ca and Mg from gilt to advanced parity to improve sow longevity and reproductive parameters and replace limestone in the sow’s diet.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This research was supported by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF-RS-2023-00275307). This research was supported by Basic Science Research Capacity Enhancement Project through Korea Basic Science Institute (National research Facilities and Equipment Center) grant funded by the Ministry of Education (Grant No. 2019R1A6C1010033).

The Department of Animal Resource & Science was supported through the Research-Focused Department Promotion & Interdisciplinary Convergence Research Projects as a part of the University Innovation Support Program for Dankook University in 2022.

We acknowledge Celtic Sea Minerals, Strand Farm, Currabinny, Carrigaline, Co. Cork, Ireland, for providing the financial support to conduct this research.

Acknowledgements

Not applicable.

Availability of data and material

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Authors’ contributions

Conceptualization: van der Veen RH, Kim IH.

Data curation: Seok WJ, Mun S, Lee H.

Formal analysis: Seok WJ, Mun S, Lee H.

Validation: van der Veen RH.

Investigation: Cho S, Upadhaya SD, Han K, Kim IH.

Writing - original draft: Cho S, Upadhaya SD.

Writing - review & editing: Cho S, Upadhaya SD, Seok WJ, Mun S, Lee H, van der Veen RH, Han K, Kim IH.

Ethics approval and consent to participate

The experimental protocol (DK-2-1927) for this study got the consent from Animal Care and Use Committee of Dankook University, Korea. The experiment was conducted at the swine experimental unit of Dankook University, Korea.

REFERENCES

1.

Ball RO, Samuel RS, Moehn S. Nutrient requirements of prolific sows. Adv Pork Prod. 2008; 19:223-37

2.

Ebert AR, Berman AS, Harrell RJ, Kessler AM, Cornelius SG, Odle J. Vegetable proteins enhance the growth of milk-fed piglets, despite lower apparent ileal digestibility. J Nutr. 2005; 135:2137-43

3.

Koketsu Y, Dial GD, Pettigrew JE, King VL. The influence of nutrient intake on biological measures of breeding herd productivity. J Swine Health Prod. 1996; 4:85-94

4.

Arthur SR, Kornegay ET, Thomas HR, Veit HP, Notter DR, Webb KE, et al. Restricted energy intake and elevated calcium and phosphorus intake for gilts during growth. IV. Characterization of metacarpal, metatarsal, femur, humerus and turbinate bones of sows during three parities. J Anim Sci. 1983; 57:1200-14

5.

Zang J, Chen J, Tian J, Wang A, Liu H, Hu S, et al. Effects of magnesium on the performance of sows and their piglets. J Anim Sci Biotechnol. 2014; 5:39

6.

Crenshaw TD. Nutritional manipulation of bone mineralization in developing gilts.In In: Allen D, editor. Leman Swine Conference. Vol. 30 St. Paul, MN: University of Minnesota. 2003; p p. 183-9

7.

Mahan DC, Newton EA. Effect of initial breeding weight on macro- and micromineral composition over a three-parity period using a high-producing sow genotype. J Anim Sci. 1995; 73:151-8

8.

Mahan D, Taylor-Pickard J. Meeting the mineral needs of highly prolific sows. Pig Prog. 2008; 24:21-3

9.

Vonnahme KA, Lemley CO, Caton JS, Meyer AM. Impacts of maternal nutrition on vascularity of nutrient transferring tissues during gestation and lactation. Nutrients. 2015; 7:3497-523

10.

Thayer ZM, Rutherford J, Kuzawa CW. The Maternal Nutritional Buffering Model: an evolutionary framework for pregnancy nutritional intervention. Evol Med Public Health. 2020; 2020:14-27

11.

Christian P, Stewart CP. Maternal micronutrient deficiency, fetal development, and the risk of chronic disease. J Nutr. 2010; 140:437-45

12.

Zemel MB, Shi H, Greer B, Dirienzo D, Zemel PC. Regulation of adiposity by dietary calcium. FASEB J. 2000; 14:1132-8

13.

Zemel MB. Role of dietary calcium and dairy products in modulating adiposity. Lipids. 2003; 38:139-46

14.

Parikh SJ, Yanovski JA. Calcium intake and adiposity. Am J Clin Nutr. 2003; 77:281-7

15.

Zemel MB, Sun X. Dietary calcium and dairy products modulate oxidative and inflammatory stress in mice and humans. J Nutr. 2008; 138:1047-52

16.

Gao L, Xie C, Zhang T, Wu X, Yin Y. Maternal supplementation with calcium varying with feeding time daily during late pregnancy affects lipid metabolism and transport of placenta in pigs. Biochem Biophys Res Commun. 2018; 505:624-30

17.

Zenk JL, Frestedt JL, Kuskowski MA. Effect of calcium derived from Lithothamnion sp. on markers of calcium metabolism in premenopausal women. J Med Food. 2018; 21:154-8

18.

Brennan O, Sweeney J, O’Meara B, Widaa A, Bonnier F, Byrne HJ, et al. A natural, calcium-rich marine multi-mineral complex preserves bone structure, composition and strength in an ovariectomised rat model of osteoporosis. Calcif Tissue Int. 2017; 101:445-55

19.

O’Driscoll K, O’Gorman DM, Taylor S, Boyle LA. The influence of a magnesium-rich marine extract on behaviour, salivary cortisol levels and skin lesions in growing pigs. Animal. 2013; 7:1017-27

20.

NRC [National Research Council]. Nutrient requirements of swine. 11th ed Washington, DC: National Academies Press. 2012

21.

AOAC [Association of Official Analytical Chemists] International. Official methods of analysis AOAC International. 17th ed Arlington, VA: AOAC International. 2000

22.

Crocker WP, Jenkins DI, Provan AL, Macdonald FJ, Rowland SJ, White JCD. A comparison of the Gerber and Röse Gottlieb methods for the determination of fat in milk. J Dairy Res. 1955; 22:336-9

23.

Regnault TRH, Friedman JE, Wilkening RB, Anthony RV, Hay WW. Fetoplacental transport and utilization of amino acids in IUGR-a review. Placenta. 2005; 26:S52-62

24.

Lager S, Powell TL. Regulation of nutrient transport across the placenta. J Pregnancy. 2012; 2012:179827

25.

Miller MB, Hartsock TG, Erez B, Douglass L, Alston-Mills B. Effect of dietary calcium concentrations during gestation and lactation in the sow on milk composition and litter growth. J Anim Sci. 1994; 72:1315-9

26.

Sampath H, Ntambi JM. The role of stearoyl-CoA desaturase in obesity, insulin resistance, and inflammation. Ann N Y Acad Sci. 2011; 1243:47-53

27.

Marchioro L, Hellmuth C, Uhl O, Geraghty AA, O’Brien EC, Horan MK, et al. Associations of maternal and fetal SCD-1 markers with infant anthropometry and maternal diet: findings from the ROLO study. Clin Nutr. 2020; 39:2129-36

28.

Wang P, Zhu Q, Peng H, Du M, Dong M, Wang H. Fatty acid-binding protein 4 in endometrial epithelium is involved in embryonic implantation. Cell Physiol Biochem. 2017; 41:501-9

29.

Thorens B. GLUT2, glucose sensing and glucose homeostasis. Diabetologia. 2015; 58:221-32

30.

Svajgr AJ, Peo ER, Vipperman PE. Effects of dietary levels of manganese and magnesium on performance of growing-finishing swine raised in confinement and on pasture. J Anim Sci. 1969; 29:439-43

31.

Nuoranne PJ, Raunio RP, Saukko P, Karppanen H. Metabolic effects of a low-magnesium diet in pigs. Br J Nutr. 1980; 44:53-60

32.

Delouis C. Physiology of colostrum production. Ann Rech Vet. 1978; 9:193-203

33.

Theil PK, Hurley WL. The protein component of sow colostrum and milk.In In: Gigli I, editor.editor Milk proteins - from structure to biological properties and health aspect. Reijeka: IntechOpen. 2016; p p. 183-98

34.

Le Dividich J, Rooke JA, Herpin P. Nutritional and immunological importance of colostrum for the new-born pig. J Agric Sci. 2005; 143:469-85

35.

Krakowski L, Krzyżanowski J, Wrona Z, Kostro K, Siwicki AK. The influence of nonspecific immunostimulation of pregnant sows on the immunological value of colostrum. Vet Immunol Immunopathol. 2002; 87:89-95

36.

Quesnel H. Colostrum production by sows: variability of colostrum yield and immunoglobulin G concentrations. Animal. 2011; 5:1546-53

37.

van Heugten E. Magnesium in pig nutrition [Internet]. Professional Pig Community 2009.[cited 2023 Jun 12]https://www.pig333.com/articles/magnesium-in-pig-nutrition_580/.

38.

Farmer C, Robert S, Matte JJ, Girard CL, Martineau GP. Endocrine and peripartum behavioral responses of sows fed high-fiber diets during gestation. Can J Anim Sci. 1995; 75:531-6

39.

Quesnel H, Ramaekers P, van Hees H, Farmer C. Short communication: relations between peripartum concentrations of prolactin and progesterone in sows and piglet growth in early lactation. Can J Anim Sci. 2013; 93:109-12

40.

Carney-Hinkle EE, Tran H, Bundy JW, Moreno R, Miller PS, Burkey TE. Effect of dam parity on litter performance, transfer of passive immunity, and progeny microbial ecology. J Anim Sci. 2013; 91:2885-93

41.

Declerck I, Dewulf J, Piepers S, Decaluwé R, Maes D. Sow and litter factors influencing colostrum yield and nutritional composition. J Anim Sci. 2015; 93:1309-17

42.

Segura M, Martínez-Miró S, López MJ, Madrid J, Hernández F. Effect of parity on reproductive performance and composition of sow colostrum during first 24 h postpartum. Animals. 2020; 10:1853

43.

Luise D, Cardenia V, Zappaterra M, Motta V, Bosi P, Rodriguez-Estrada MT, et al. Evaluation of breed and parity order effects on the lipid composition of porcine colostrum. J Agric Food Chem. 2018; 66:12911-20

44.

Roelofs S, Godding L, de Haan JR, van der Staay FJ, Nordquist RE. Effects of parity and litter size on cortisol measures in commercially housed sows and their offspring. Physiol Behav. 2019; 201:83-90

45.

Upadhaya SD, Seok WJ, Kumar SS, van der Veen RH, Kim IH. Marine derived Ca-Mg complex supplementation basal diet during four subsequent parities improved longevity and performance of sows and their litters. J Anim Sci Technol. 2023; 65:562-78

Revised Publication Charge


(Effective for articles submitted beginning January 1, 2026)

The publication charge is 1,500,000 Korean Won per article for members of the Korean Society of Animal Science and Technology (KSAST), and 2,000,000 Korean Won for non-members. First and corresponding authors are required to pay the annual membership fee.

The publication charge for a corresponding author outside Korea is 1,500 US dollars per article.


I don't want to open this window for a week.