RESEARCH ARTICLE

mRNA expression of myogenic-adipogenic makers and adipocyte in skeletal muscle of Hanwoo calves at newborn and 6 months of age

Jun-Sang Ahn1https://orcid.org/0000-0001-7362-9270, Ki-Yong Chung2https://orcid.org/0000-0003-0957-875X, Sun-Sick Jang1https://orcid.org/0000-0002-8121-4697, Ui-Hyung Kim1https://orcid.org/0000-0002-2197-5080, So-Mi Hwang1https://orcid.org/0000-0002-4152-5984, Shil Jin1https://orcid.org/0000-0003-1120-3631, Bo-Hye Park1https://orcid.org/0000-0003-3081-5916, Dong-Hun Kang2https://orcid.org/0000-0001-7275-7705, Eung-Gi Kwon1,*https://orcid.org/0000-0002-5585-5909
Author Information & Copyright
1Hanwoo Research Institute, National Institute of Animal Science, RDA, Pyeongchang 25340, Korea
2Department of Beef Science, Korea National College of Agriculture and Fisheries, Jeonju 54874, Korea
*Corresponding author: Eung-Gi Kwon, Hanwoo Research Institute, National Institute of Animal Science, RDA, Pyeongchang 25340, Korea., Tel: +82-33-330-0612, E-mail: Kug2237@korea.kr

© Copyright 2020 Korean Society of Animal Science and Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Jun 16, 2020; Revised: Aug 14, 2020; Accepted: Aug 18, 2020

Published Online: Nov 30, 2020

Abstract

This study was conducted to compare the mRNA expression levels of myogenic-adipogenic makers in the skeletal muscle and adipocytes formation, body weight, rumen weight, and papilla length on Hanwoo calves at newborn and 6 months of age. Animals used three newborn Hanwoo calves (NC) and three Hanwoo calves 6 months of age (SC). Body weight and rumen weight were significantly increased in SC compared to NC (p < 0.01), and papilla length was longer about 10-fold in SC than NC. Adipocytes was possible to visually identify more adipocytes in SC compared to NC, and were mainly formed around the blood vessels. mRNA expression of myogenin, myosin heavy chain 1 and myosin heavy chain 2A in both longissimus dorsi (LD) and semimembranosus (SM) was found to increase with calves growth (p < 0.01), and it was confirmed that have higher levels of mRNA expression in SM than LD. In LD tissues, the mRNA expression of stearoyl-CoA desaturase (SCD, p < 0.03) and peroxisome proliferator activated receptor γ (PPARγ, p < 0.04) was significantly higher in SC than NC. In SM tissues, mRNA expression levels of SCD (p < 0.02) and CCAAT/enhancer binding protein β (C/EBPβ, p < 0.01) were higher in SC than NC, and also mRNA expression levels of PPARγ increased, but there was no significant difference. Thus, the calves period suggests that it is an important step in the development of the rumen and the myogenesis and adipogenesis.

Keywords: Hanwoo calves; Adipocytes; Myogenic; Adipogenic

INTRODUCTION

Calves are supplied with nutrients from milk and grain starter, and this helps in the development of the skeleton, muscles and the accumulation fats during their growth stage. In particular, the number of adipocytes increases during growth [1], and the rumen and papilla which are essential for digestion and absorption of nutrients are also remarkably developed at this stage [2]. Therefore, understanding the physiological mechanism of calf growth and researching related fields is important for improving the ability and quality of Hanwoo calves. Unfortunately, in the case of Hanwoo cattle, most studies have concentrated on improving intramuscular fat with a focus on the finishing phase, while only a few studies have focused on calves.

As the genome information sequence of livestock is completed and molecular genetics and genomic technology is rapidly developing, the interaction of genes with nutrients is being revealed [3]. The formation of muscle fibers and adipocytes is directly and indirectly influenced by the expression and regulation of various genes [1]. Major gene groups are used as markers to assess an individual’s ability or to improve traits. Gene expression is influenced by genetic and environmental factors, and is differentially expressed in the growth period [4]. Understanding the expression patterns of myogenic and adipogenic genes in the growing stages of calves and distinguishing the main genes is necessary for improving the productivity of Hanwoo.

Therefore, this study was conducted to provide as basic data for improves productivity, such as improving the quality of beef and shortening the fattening period through compare of mRNA expression levels of myogenic-adipogenic makers in the skeletal muscle, adipocytes formation, body weight, rumen weight, and papillary length on Hanwoo calves at newborn and 6 months of age.

MATERIALS AND METHODS

Ethics statement

The management of the Hanwoo calves used for the study and all experimental procedures were examined and permitted by the Institutional Animal Care and Use Committee of the National Institute of Animal Science (No. 2017-119).

Management and use of animals

Three newborn calves (NC, average body weight: 24.7 ± 0.6 kg), and three 5 to 6 months old calves (SC, average body weight : 105.7 ± 3.2 kg) were used for the study. SC was weaned at 3 months of age, and concentrate and timothy were fed until slaughter. Chemical compositions of the concentrate and timothy used in this study are shown in Table 1.

Table 1. Chemical composition of concentrate and timothy (as-basis)
Item Concentrate (%) Timothy (%)
Dry matter 88.76 91.38
Crude protein 17.39 6.58
Ether extract 3.26 2.92
Crude ash 6.10 4.55
Crude fiber 7.86 30.47
Calcium 0.89 0.22
Phosphorous 0.64 0.22
Download Excel Table
Tissue sample collection

After calves slaughter, samples were collected from both sides after removal of the skin and subcutaneous fat at the site of the longissimus dorsi (LD) and semimembranosus (SM). At the same time, the rumen was separated from the calves, and the rumen contents were removed, and followed by weighing and sample collection. Tissue samples (LD, SM and rumen) were each placed in a sterile tube and were immediately frozen in liquid nitrogen, and it was stored at −80°C until the RNA isolation. Another portion of the samples were fixed in formalin (10%) for histological analysis.

Real-time quantitative polymerase chain reaction analysis

Samples from the LD and SM were transferred into 2 mL screw tubes, and 1 mL of TRIzol (Ambion, Carlsbad, CA, USA) and 2 beads were added. The samples were then homogenized for 2 min using a homogenizer (TissueLyser 2, Qiagen, Hilden, Germany), and later transferred into new microtubes. 100 μL of chloroform was subsequently poured into the microtubes and mixed using vortex. Centrifugation was performed at 16,996×g for 15 min using a centrifuge (MICRO 17TR, Hanil, Namyangju, Korea) and the supernatants transferred into new microtubes. After transferring the supernatant into new micro tubes, equal amount of isopropyl alcohol was added, and centrifugation was performed again for 10 min at 16,996×g and the supernatants were removed. Thereafter, 1 mL of 75% ethanol was added and centrifuged at 10,623×g for 5 min, the resulting supernatants were removed, and the samples were dried. RNA of the dried samples was dissolved by adding diethyl pyrocarbonate (DEPC) - treated water. cDNA was synthesized using cDNA synthesis kits (Rever Tra Ace® qPCR RT Master Mix with gDNA Remover, TOYOBO, Osaka, Japan) after measuring the concentration using 2 μL of DEPC containing RNA.

Real-time PCR analysis was performed using 7500 Fast Real-Times PCR system (Applied Biosystems, Foster City, CA, USA), and the myogenic markers used were myogenin (MyoG), myosin heavy chain 1 (MYH 1) and myosin heavy chain 2A (MYH 2A), while adipogenic markers were CCAAT/enhancer binding protein β (C/EBPβ), peroxisome proliferator activated receptor γ (PPARγ) and stearoyl-CoA desaturase (SCD). The primer sets used are shown in Table 2. 5.5 μL of distilled water and 2 μL of cDNA were injected on the plate, 1 μL of forward and reverse primers and 0.5 μL of probe were added, respectively. Finally, after adding 10 μL of Master Mix, the analysis was performed. The reaction conditions were as follows: 2 min at 50°C, 10 min at 95°C on the holding stage, and 15 s at 95°C, followed by reaction at 60°C for 1 min on the cycling stage. With this process as one cycle, a total of 40 cycles were performed.

Table 2. Primers for genes analyzed by real-time quantitative polymerase chain reaction
Gene Gene abbreviation Accession no. Forward sequence Reverse sequence
Myogenin MyoG AF091714 AGAAGGTGAATGAAGCCTTCGA GCAGGCGCTCTATGTACTGGAT
Myosin heavy chain 1 MHC 1 AB059400 CCCACTTCTCCCTGATCCACTAC TTGAGCGGGTCTTTGTTTTTCT
Myosin heavy chain 2A MHC 2A AB059398 CCCCGCCCCACATCTT TCTCCGGTGATCAGGATTGAC
CCAAT/enhancer binding protein β C/EBPβ NM_176788 CCAGAAGAAGGTGGAGCAACTG TCGGGCAGCGTCTTGAAC
Peroxisome proliferator activated receptor γ PPARγ NM_181024 ATCTGCTGCAAGCCTTGGA TGGAGCAGCTTGGCAAAGA
Stearoyl-CoA desaturase SCD AB075020 TGCCCACCACAAGTTTTCAG GCCAACCCACGTGAGAGAAG
Download Excel Table
Tissue sections and staining

Tissue samples were rinsing and immersed in 10%, 20%, and 30% sucrose solutions. The immersed tissues were embedded in an OCT compound and rapidly frozen. After freezing, each sample was sliced to a thickness of about 10 µm using a freeze slicer, and the sliced tissues were attached to silane coated slide glasses.

Tissue slides was washed with phosphate buffer saline (PBS). For the permeabilization, PBS-containing either 0.1% Triton X-100 (Sigma, Sant Louise, MO, USA) solution was added to the slides, and incubated at room temperature for 30 min. After incubation at room temperature for 30 min, 10% Albumin from bovine serum (BSA, Sigma, Sant Louise, MO, USA) + 22.52 mg/mL glycine in PBS + 0.1% Tween 20 (PBST) blocking solution was added. After removing the blocking solution, PBST solution of myosin light chain 2 (MLC2) primary antibody (Abcam, Cambridge, UK) diluted to 1/2,000 was subsequently added, and incubated for 1 h in a dark environment at room temperature, and washed with high salt PBS. The diluted (1/200) secondary antibody solution (Abcam, Cambridge, UK) was incubated in the dark at room temperature, and then wash with high salt PBS. 400 μL of body fit solution was added and incubated for 1 h in a dark environment at room temperature. Then wash with high salt PBS. Hoechst was diluted to 1/1,000, dispensed, incubated for 1 min in a dark environment, and washed with PBS. Finally, glycerin was added and the slides were covered with cover glass, and were observed with an optical microscope (ECLIPSE Ti-U, Nikon, Tokyo, Japan)

Statistical analysis

A generalized linear model (GLM) was used for the analysis and mean comparison using SAS 9.4 version, and the fixed effect (birth, 6 months of age) was assessed for significance at 5% confidence level by t-test.

Y ij = μ + month i + e ij

Where, Yij = individual observations, µ = overall mean, monthi = age of calves (newborn and 6 months of age), and eij = random error.

RESULTS

Body weight and rumen

The results of body weight, rumen weight and papilla on Hanwoo calves at newborn and 6 months of age are shown in Table 3 and Fig. 1. Body weight and rumen weight were significantly increased in SC compared to NC (p < 0.01), and the growth rate of rumen was higher than that of body weight. The ratio of rumen to body weight was approximaely 2.5-fold higher in SC than NC (p < 0.01), and papilla length was about 10-fold longer in SC than NC.

Table 3. Comparison of body weight and rumen in Hanwoo calves at newborn and 6 months of age
Item NC SC SEM p-value
Body weight (kg) 24.7b 105.7a 1.09 0.01
Rumen weight (kg) 0.51b 5.52a 0.12 0.01
R/B rate (%) 2.05b 5.22a 0.12 0.01
Papilla length (mm) 0.33b 3.43a 0.06 0.01

a,b Means without same superscripts within a row are significantly different (p < 0.05).

NC, newborn calves; SC, 5 to 6 months calves; R/B rate, rumen weight/body weight.

Download Excel Table
jast-62-6-893-g1
Fig. 1. Comparison of rumen papilla length in Hanwoo calves at newborn (A) and 6 months of age (B). Hematoxylin and Eosin (H&E) Stain, Magnification × 20.
Download Original Figure
Adipocytes distribution

The results of immunofluorescence staining on skeletal muscle in Hanwoo calves at newborn and 6 months of age are shown in Fig. 2. Adipocytes were noticed in the LD and SM tissues regardless of the calves growth stage, and were mainly formed around blood vessels. In addition, adipocytes were more easily visualized in SC than in NC, and the area ratio of adipocytes in LD and SM tissue also showed higher results in SC than NC.

jast-62-6-893-g2
Fig. 2. The results of immunofluorescence staining on skeletal muscle in Hanwoo calves at newborn and 6 months of age. (A) NC-LD, (B) SC-LD, (C) NC-SM, (D) SC-SM. Blue: DAPI,4’6-diamidino-2-phenylindole (DNA); Green: BODIPY, 4,4-difluoro-1,3,5,7,8-pentamethyl-4-bora-3a,4a-diaza-s-indacene (Lipid); Red: MLC, myosin light chain (muscle). NC, newborn calves; LD, longissimus dorsi; SC, 5 to 6 months calves; SM, semimembranosus.
Download Original Figure
Makers of myogenic and adipogenic

mRNA expression of myogenic-adipogenic makers on skeletal muscle in Hanwoo calves at newborn and 6 months of age are shown in Table 4. mRNA expression of myogenin (p < 0.01), MYH 1 (p < 0.02) and MYH 2A (p < 0.01) in LD was found to increase with calves growth. Also at the SM, mRNA expression was higher in SC compared to NC (p < 0.01). In addition, it was discovered that both NC and SC had higher levels of mRNA expression in the SM than in the LD.

Table 4. mRNA expression levels of myogenic-adipogenic markers on skeletal muscle in Hanwoo calves at newborn and 6 months of age
Gene expression, arbitrary units NC SC SEM p-value
Longissimus dorsi
 Myogenic markers
 MyoG 0.09b 0.37a 0.05 0.01
 MYH 1 2.96 12.48a 1.94 0.02
 MYH 2A 0.64b 4.09a 0.61 0.01
 Adipogenic markers
 SCD 0.59b 1.35a 0.17 0.04
 PPARγ 2.33b 4.97a 0.56 0.03
 C/EBPβ 57.67 67.32 6.57 0.53
Semimembranosus
 Myogenic markers
 MyoG 0.72b 2.63a 0.39 0.01
 MYH 1 26.47b 69.87a 8.03 0.01
 MYH 2A 2.35b 6.12a 0.76 0.01
Adipogenic markers
 SCD 3.50b 8.72a 1.03 0.02
 PPARγ 1.68 3.35 0.45 0.11
 C/EBPβ 10.70b 20.08a 1.76 0.01

a,b Means without same superscripts within a row are significantly different (p < 0.05).

NC, newborn calves; SC, 5 to 6 months calves; MyoG, myogenin; MYH 1, myosin heavy chain 1; MYH 2A, myosin heavy chain 2A; SCD, stearoyl-CoA desaturase; PPARγ, peroxisome proliferator activated receptor γ; C/EBPβ, CCAAT/enhancer binding protein β.

Download Excel Table

In LD tissues, the mRNA expression of SCD (p < 0.04) and PPARγ (p < 0.03) was significantly higher in SC than NC. However the mRNA expression of C/EBPβ was slightly increased. In SM tissues, mRNA expression levels of SCD (p < 0.02) and C/EBPβ (p < 0.01) were higher in SC than NC, and mRNA expression levels of PPARγ also increased, but there was no significant difference.

DISCUSSION

The rumen is the largest digestive organ in ruminants, it is responsible for several physiologically important functions, including digestion, absorption, transport, and metabolism of short-chain fatty acids [5,6]. The rumen of the newborn calf occupies approximately 20% of the total stomach volume, the rumen development is completed at 14 to 16 weeks of age, and the composition of the rumen microbial community is established during the early growth periods [7]. Lyford [8] reported that the rumen to total stomach ratio of newborn calf is around 35% (95 g), but rapidly develops to 68% (2,040 g) at 17 weeks of age, and then maintains a similar rate until adulthood. In addition, the major microbial populations found in mature ruminants are already present in the rumen at 1–3 days of age [9,10]. It has been reported that it takes approximately 3 to 4 weeks to stabilize the inter-microbial community system after the initial microbiota is formed [11,12]. In general, rumen development can be largely divided into increase of rumen mass and papilla growth. Once the calf begins to consume solid feed and rumen fermentation is established, it undergoes both physical and metabolic development [13]. Physical stimulation by feed could increase rumen weight and muscle development [14], but volatile fatty acids are necassary for papilla development [15]. Soomro et al. [16] reported that feeding butyrate at 0.3/kg BW significantly increased the length and thickness of the rumen papilla, and Zhang et al. [17] reported that feeding 5% calcium salt propionic acid significantly increased papilla length and mRNA expression of GPR41, GPR43, and CCND1. For the simultaneous development of the rumen size (volume and muscle) and papilla, it is necessary to feed the calf with an appropriate proportion of concentrate and hay. Žitnan et al. [18] reported that feeding concentrate to young calves stimulated the development of the rumen epithelium (papilla), whereas feed with large particle size or high fiber are the main stimulant for rumen muscularization and volume. In the present study, the increase in rumen weight and improvement of papilla was higher than the overall weight gain in relation to the growth stages (newborn - 6 months) of the Hanwoo calves (Table 3 and Fig. 1). This suggests that similar to previous studies, rapid development of rumen masses and papilla occurs at the calf stage in Hanwoo cattle.

Considerable effort has been made to improve meat quality by increasing intramuscular adipogenesis. Most of these efforts focus on nutritional management in the finishing phase. On the other hand, studies on “Fetal programming [19]” and “Metabolic imprinting [20]” have been conducted to improve intramuscular fat through nutritional management during maternal (pregnancy) or at the calf stage. One of the important objectives of this study was to increase initial adipogenesis. Adipogenesis starts at mid gestation and persists after the birth of the calves. However, after approximately 250 days of age, it is more effective to increase the size of intramuscular adipocytes than to increase the number of intramuscular adipocytes due to the depletion of pluripotent cells [1]. In this study, the numbers of adipocytes in the LD and SM, and the mRNA expression of the adipogenic genes were higher in the SC than in NC, suggesting that in Hanwoo cattle, adipogenesis increases with the during growth of the calves, as reported in previous studies. Therefore, special supplements (energy, protein, vitamins, etc.) during this period could be an important key to effectively improving intramuscular fat. In studies of other cattle breeds [2123], grain and corn-based feeds during early weaning or early calf stages has been reported to increase intramuscular fat. This suggests that high energy supply to early calf is one of the major factors in adipogenesis.

Various genes are expressed during calf growth, and some specific genes affect muscle and fat development. MyoG is known to be involved in the stimulation of muscle growth by inducing myogenesis, and contributes in the formation muscle cells [24]. In addition, it has been reported to be directly involved in muscle growth (muscle hypertrophy), and affects carcass weight [25,26]. Myosin heavy chain is involved in muscle contraction and force generation [27], and there are four isoforms in the mammalian skeletal muscle [28]. Among these, MYH 1 has low adenosine triphosphatase (ATPase) activity, slow contraction, and is necessary for the maintenance of posture, and is often found in red muscles [28]. MYH 2A is abundant in muscles that are continuously in use, and metabolic activities are high in this muscle due to oxidation and glycolysis [29,30]. In the present study, the increase in mRNA expression of MyoG, MYH 1, and MYH 2A in SC than NC is considered to be due to the muscle fiber hypertrophy resulting from growth, and increase in muscle activity. In addition, the reason for the higher expression of mRNA in SM than LD could be attributed to its role in supporting the body and its involvement in mobility.

On the other hand, adipocytes play an important role in energy regulation and homeostasis, and the differentiation of matured adipocyte is known to be regulated by transcription factors such as C/EBP family and PPARγ [31]. In particular, C/EBPβ not only regulates the expression and activity of PPARγ, but it has also has been reported to be involved in the synthesis of PPARγ ligand [32]. Differentiation of adipocytes is also caused by stem cells present in the muscle [33], and proliferation, differentiation and size of adipocytes in muscles are closely related to marbling score [33,34]. Mitochondria use energy and fatty acids to form acetyl-coA, which is used as a precursor for intramuscular fat synthesis [4]. Acetyl-coA synthesizes long chain fatty acids (saturated fatty) through the actions of various enzymes, and finally SCD converts saturated fatty acids into monounsaturated fatty acids to enable the accumulation of fat [35]. In the present study, we found that the mRNA expression level of SCD was increased in both LD and SM in relation to the calves growth stage, indicating fat accumulation was actively progressing. In addition, although it was inconsistent in both LD and SM, it was found that adipogenesis continued during calves stage because the mRNA expression of C/EBPβ and PPARγ tended to significantly increase with calves growth. Etoh et al. [36] reported that PPARγ and SCD expression was continuously increased in LD of 45 day, 4- and 10-month-old calves, and C/EBPα showed little difference between 45 days and 4 months, and it tended to increase at 10 months of age. It was concluded that the difference in feed quality during the early growth stage of calves has a substantial effect on the expression of genes involved in adipogenesis and fatty acid synthesis.

CONCLUSION

In the results of this study, Hanwoo calves were found to become significantly increased rumen weight and papiila length for 6 months after birth, and increased adipocytes formation and mRNA expression of myogenic-adipogenic makers in skeletal muscle. Thus, the calves period suggests that it is an important step in the development of the rumen for digestion and absorption and the myogenesis and adipogenesis. In addition, it is necessary to investigate additional data during the growing and fattening period, and further, studies such as the adjustment of nutritional levels, functional substances, and exploration of genetic markers to promote growth, rumen development, and adipocytes formation during the calves period are needed.

Competing interests

No potential conflict of interest relevant to this article was reported.

Funding sources

This research was supported by a grant “Study of muscle and potential marbling fat related tissue development on the Hanwoo fetus and calf (PJ01361501)” from the National Institute of Animal Science, Rural Development Administration, Korea.

Acknowledgements

This research was supported by a grant “Study of muscle and potential marbling fat related tissue development on the Hanwoo fetus and calf (PJ01361501)” from the National Institute of Animal Science, Rural Development Administration, Korea.

Availability of data and material

Upon reasonable request, the datasets of this study can be available from the corresponding author.

Authors’ contributions

Conceptualization: Chung KY, Kwon EG.

Data curation: Ahn JS, Jang SS, Park BH, Kang DH.

Formal analysis: Jang SS, Kim UH.

Methodology: Park BH, Kang DH.

Software: Ahn JS, Hwang SM, Jin S.

Validation: Jin S, Park BH, Kang DH.

Investigation: Ahn JS, Hwang SM, Park BH, Kang DH.

Writing - original draft: Ahn JS, Kwon EG.

Writing - review & editing: Ahn JS, Chung KY, Jang SS, Kim UH, Hwang SM, Jin S, Park BH, Kang DH, Kwon EG.

Ethics approval and consent to participate

The management of the Hanwoo calves used for the study and all experimental procedures were examined and permitted by the Institutional Animal Care and Use Committee of the National Institute of Animal Science (No. 2017-119).

REFERENCES

1.

Du M, Tong J, Zhao J, Underwood KR, Zhu M, Ford SP, et al. Fetal programming of skeletal muscle development in ruminant animals. J Anim Sci. 2010; 88:51-60

2.

Baldwin RL, McLeod KR, Klotz JL, Heitmann RN. Rumen development, intestinal growth and hepatic metabolism in the pre-and postweaning ruminant. J Dairy Sci. 2004; 87:55-65

3.

Lee SH, Cho YM, Lee JH, Oh SJ. Implementation of genomic selection in Hanwoo breeding program. J Agric Sci. 2015; 42:397-406

4.

Lee SH, Park EW, Cho YM, Kim KH, Oh YK, Lee JH, , et al. Lipogenesis gene expression profiling in longissimus dorsi on the early and late fattening stage of Hanwoo. J Anim Sci Technol. 2006; 48:345-52

5.

Stevens CE. Fatty acid transport through the rumen epithelium.In In: Phillipson AT, editor.editor Physiology of digestion and metabolism in the ruminant. Newcastle: Oriel Press. 1970; p p. 101-12

6.

Gálfi P, Neogrády S, Sakata T. Effects of volatile fatty acids on the epithelial cell proliferation of the digestive tract and its hormonal mediation.In In: Tsuda T, Sasaki Y, Kawashima R, editors.editors Physiological aspects of digestion and metabolism in ruminants: proceedings of the Seventh International Symposium on Ruminant Physiology. San Diego, CA: Academic Press. 1991

7.

Sato T, Hidaka K, Mishima T, Nibe K, Kitahara G, Hidaka Y, et al. Effect of sugar supplementation on rumen protozoa profile and papillae development in retarded growth calves. J Vet Med Sci. 2010; 72:1471-4

8.

Lyford SJ. Growth and development of the ruminant digestive system.In In: Church DC, editor.editor The ruminant animal. Englewood Cliffs, NJ: Prentice Hall. 1988; p p. 44-63

9.

Jami E, Israel A, Kotser A, Mizrahi I. Exploring the bovine rumen bacterial community from birth to adulthood. ISME J. 2013; 7:1069-79

10.

Morvan B, Dore J, Rieu-Lesme F, Foucat L, Fonty G, Gouet P. Establishment of hydrogen-utilizing bacteria in the rumen of the newborn lamb. FEMS Microbiol Lett. 1994; 117:249-56

11.

Abecia L, Ramos-Morales E, Martínez-Fernandez G, Arco A, Martín-García AI, Newbold CJ, et al. Feeding management in early life influences microbial colonisation and fermentation in the rumen of newborn goat kids. Anim Prod Sci. 2014; 54:1449-54

12.

Gupta M, Khan N, Rastogi A, Zulfqar ul Haq , Varun TK. Nutritional drivers of rumen development: a review. Agric Rev. 2016; 37:148-53

13.

Baldwin RL, McLeod KR, Klotz JL, Heitmann RN. Rumen development, intestinal growth and hepatic metabolism in the pre- and postweaning ruminant. J Dairy Sci. 2004; 87:E55-65

14.

Hamada T, Maeda S, Kameoka K. Factors influencing growth of rumen, liver, and other organs in kids weaned from milk replacers to solid foods. J Dairy Sci. 1976; 59:1110-8

15.

Flatt WP, Warner RG, Loosli JK. Influence of purified materials on the development of the ruminant stomach. J Dairy Sci. 1958; 41:1593-600

16.

Soomro J, Lu Z, Gui H, Zhang B, Shen Z. Synchronous and time-dependent expression of cyclins, cyclin-dependant kinases, and apoptotic genes in the rumen epithelia of butyrate-infused goats. Front Physiol. 2018; :9-496

17.

Zhang XZ, Chen WB, Wu X, Zhang YW, Jiang YM, Meng QX, et al. Calcium propionate supplementation improves development of rumen epithelium in calves via stimulating G protein-coupled receptors. Animal. 2018; 12:2284-91

18.

Žitnan R, Voigt J, Schönhusen U, Wegner J, Kokardová M, Hagemeister H, et al. Influence of dietary concentrate to forage ratio on the development of rumen mucosa in calves. Arch Anim Nutr. 1998; 51:279-91

19.

Duarte MS, Gionbelli MP, Paulino PVR, Serão NVL, Nascimento CS, Botelho ME, et al. Maternal overnutrition enhances mRNA expression of adipogenic markers and collagen deposition in skeletal muscle of beef cattle fetuses. J Anim Sci. 2014; 92:3846-54

20.

Gotoh T, Etoh K, Saitoh K, Metoki K, Kaneda S, Abe T, et al. Metabolic imprinting effect in beef production: influence of nutrition manipulation during an early growth stage on carcass characteristics and intramuscular fat content of longissimus muscle in Wagyu (Japanese Black).In Proceeding of the 3rd EAAP International Symposium on Energy and Protein Metabolism and Nutrition. 2010 Parma, Italy.

21.

Wertz AE, Berger LL, Walker PM, Faulkner DB, McKeith FK, Rodriguez-Zas SL. Early-weaning and postweaning nutritional management affect feedlot performance, carcass merit, and the relationship of 12th-rib fat, marbling score, and feed efficiency among Angus and Wagyu heifers. J Anim Sci. 2002; 80:28-37

22.

Pyatt NA, Berger LL, Faulkner DB, Walker PM, Rodriguez-Zas SL. Factors affecting carcass value and profitability in early-weaned Simmental steers: I. five-year average pricing. J Anim Sci. 2005; 83:2918-25

23.

Pyatt NA, Berger LL, Faulkner DB, Walker PM, Rodriguez-Zas SL. Factors affecting carcass value and profitability in early-weaned Simmental steers: II. days on feed endpoints and sorting strategies. J Anim Sci. 2005; 83:2926-37

24.

Arnold HH, Braun T. Genetics of muscle determination and development. Curr Top Dev Biol. 1999; 48:129-64

25.

Dwyer CM, Fletcher JM, Stickland NC. Muscle cellularity and postnatal growth in the pig. J Anim Sci. 1993; 71:3339-43

26.

Lyons GE, Swanson BJ, Kim SK, Herr MJ, Micales BK. In situ analysis of muscle gene expression in mouse embryos. J Anim Sci. 1996; 74Suppl 2:1-8

27.

Goldspink G, Scutt A, Loughna PT, Wells DJ, Jaenicke T, Gerlach GF. Gene expression in skeletal muscle in response to stretch and force generation. Am J Physiol Regul Inter Comp Physiol. 1992; 262:R356-63

28.

Beak SJ, Kim DH, Kim JS. Review of the muscle plasticity. J Korean Soc Phys Ther. 2003; 15:100-10

29.

Baldwin KM, Haddad F. Skeletal muscle plasticity: cellular and molecular responses to altered physical activity paradigms. Am J Phys Med Rehabil. 2002; 81:S40-51

30.

Lefaucheur L, Gerrard D. Muscle fiber plasticity in farm mammals. J Anim Sci. 2000; 77Suppl_E:1-19

31.

Brun RP, Kim JB, Hu E, Altiok S, Spiegelman BM. Adipocyte differentiation: a transcriptional regulatory cascade. Curr Opin Cell Biol. 1996; 8:826-32

32.

Hamm JK, Park BH, Farmer SR. A role for C/EBPβ in regulating peroxisome proliferator-activated receptor γ activity during adipogenesis in 3T3-L1 preadipocytes. J Biol Chem. 2001; 276:18464-71

33.

Cianzio DS, Topel DG, Whitehurst GB, Beitz DC, Self HL. Adipose tissue growth and cellularity: changes in bovine adipocyte size and number. J Anim Sci. 1985; 60:970-6

34.

Harper GS, Pethick DW. How might marbling begin?. Aust J Exp Agric. 2004; 44:653-62

35.

Sul HS, Dong W. Nutritional and hormonal regulation of enzymes in fat synthesis: studies of fatty acid synthase and mitochondrial glycerol-3-phosphate acyltransferase gene transcription. Annu Rev Nutr. 1998; 18:331-51

36.

Ebara F, Inada S, Asaoka S, Isozaki Y, Saito A, Etoh T, et al. Intensive nursing and feeding during the early growth period altered intramuscular adipogenesis in crossbred steers (Japanese black male × Holstein female). J Anim Vet Adv. 2010; 9:982-9

2019 JCR Impact Factor: 1.685

The 2019 Journal Citation Reports (JCR) was announced, and the impact factor of JAST was determined to be 1.685.

We would like to ask for your continued interest and support in our journal.

Thank you.

JAST Editorial Office


I don't want to open this window for a day.